ID: 1081536732

View in Genome Browser
Species Human (GRCh38)
Location 11:44002142-44002164
Sequence AAGGAGGACCTGTTTCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081536732_1081536739 13 Left 1081536732 11:44002142-44002164 CCAAGGTGAAACAGGTCCTCCTT No data
Right 1081536739 11:44002178-44002200 GTGGCCCCAGACCACCGGAAAGG No data
1081536732_1081536746 26 Left 1081536732 11:44002142-44002164 CCAAGGTGAAACAGGTCCTCCTT No data
Right 1081536746 11:44002191-44002213 ACCGGAAAGGGCCATTCTGGTGG No data
1081536732_1081536734 -6 Left 1081536732 11:44002142-44002164 CCAAGGTGAAACAGGTCCTCCTT No data
Right 1081536734 11:44002159-44002181 CTCCTTCCTCCTGTGTTACGTGG No data
1081536732_1081536749 28 Left 1081536732 11:44002142-44002164 CCAAGGTGAAACAGGTCCTCCTT No data
Right 1081536749 11:44002193-44002215 CGGAAAGGGCCATTCTGGTGGGG No data
1081536732_1081536738 8 Left 1081536732 11:44002142-44002164 CCAAGGTGAAACAGGTCCTCCTT No data
Right 1081536738 11:44002173-44002195 GTTACGTGGCCCCAGACCACCGG No data
1081536732_1081536748 27 Left 1081536732 11:44002142-44002164 CCAAGGTGAAACAGGTCCTCCTT No data
Right 1081536748 11:44002192-44002214 CCGGAAAGGGCCATTCTGGTGGG No data
1081536732_1081536740 14 Left 1081536732 11:44002142-44002164 CCAAGGTGAAACAGGTCCTCCTT No data
Right 1081536740 11:44002179-44002201 TGGCCCCAGACCACCGGAAAGGG No data
1081536732_1081536744 23 Left 1081536732 11:44002142-44002164 CCAAGGTGAAACAGGTCCTCCTT No data
Right 1081536744 11:44002188-44002210 ACCACCGGAAAGGGCCATTCTGG No data
1081536732_1081536750 29 Left 1081536732 11:44002142-44002164 CCAAGGTGAAACAGGTCCTCCTT No data
Right 1081536750 11:44002194-44002216 GGAAAGGGCCATTCTGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081536732 Original CRISPR AAGGAGGACCTGTTTCACCT TGG (reversed) Intergenic