ID: 1081536733

View in Genome Browser
Species Human (GRCh38)
Location 11:44002158-44002180
Sequence CACGTAACACAGGAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081536733_1081536739 -3 Left 1081536733 11:44002158-44002180 CCTCCTTCCTCCTGTGTTACGTG No data
Right 1081536739 11:44002178-44002200 GTGGCCCCAGACCACCGGAAAGG No data
1081536733_1081536744 7 Left 1081536733 11:44002158-44002180 CCTCCTTCCTCCTGTGTTACGTG No data
Right 1081536744 11:44002188-44002210 ACCACCGGAAAGGGCCATTCTGG No data
1081536733_1081536750 13 Left 1081536733 11:44002158-44002180 CCTCCTTCCTCCTGTGTTACGTG No data
Right 1081536750 11:44002194-44002216 GGAAAGGGCCATTCTGGTGGGGG No data
1081536733_1081536754 25 Left 1081536733 11:44002158-44002180 CCTCCTTCCTCCTGTGTTACGTG No data
Right 1081536754 11:44002206-44002228 TCTGGTGGGGGACAGGAGAAGGG No data
1081536733_1081536749 12 Left 1081536733 11:44002158-44002180 CCTCCTTCCTCCTGTGTTACGTG No data
Right 1081536749 11:44002193-44002215 CGGAAAGGGCCATTCTGGTGGGG No data
1081536733_1081536748 11 Left 1081536733 11:44002158-44002180 CCTCCTTCCTCCTGTGTTACGTG No data
Right 1081536748 11:44002192-44002214 CCGGAAAGGGCCATTCTGGTGGG No data
1081536733_1081536753 24 Left 1081536733 11:44002158-44002180 CCTCCTTCCTCCTGTGTTACGTG No data
Right 1081536753 11:44002205-44002227 TTCTGGTGGGGGACAGGAGAAGG No data
1081536733_1081536740 -2 Left 1081536733 11:44002158-44002180 CCTCCTTCCTCCTGTGTTACGTG No data
Right 1081536740 11:44002179-44002201 TGGCCCCAGACCACCGGAAAGGG No data
1081536733_1081536738 -8 Left 1081536733 11:44002158-44002180 CCTCCTTCCTCCTGTGTTACGTG No data
Right 1081536738 11:44002173-44002195 GTTACGTGGCCCCAGACCACCGG No data
1081536733_1081536756 29 Left 1081536733 11:44002158-44002180 CCTCCTTCCTCCTGTGTTACGTG No data
Right 1081536756 11:44002210-44002232 GTGGGGGACAGGAGAAGGGGTGG No data
1081536733_1081536757 30 Left 1081536733 11:44002158-44002180 CCTCCTTCCTCCTGTGTTACGTG No data
Right 1081536757 11:44002211-44002233 TGGGGGACAGGAGAAGGGGTGGG No data
1081536733_1081536755 26 Left 1081536733 11:44002158-44002180 CCTCCTTCCTCCTGTGTTACGTG No data
Right 1081536755 11:44002207-44002229 CTGGTGGGGGACAGGAGAAGGGG No data
1081536733_1081536751 18 Left 1081536733 11:44002158-44002180 CCTCCTTCCTCCTGTGTTACGTG No data
Right 1081536751 11:44002199-44002221 GGGCCATTCTGGTGGGGGACAGG No data
1081536733_1081536746 10 Left 1081536733 11:44002158-44002180 CCTCCTTCCTCCTGTGTTACGTG No data
Right 1081536746 11:44002191-44002213 ACCGGAAAGGGCCATTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081536733 Original CRISPR CACGTAACACAGGAGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr