ID: 1081536737

View in Genome Browser
Species Human (GRCh38)
Location 11:44002168-44002190
Sequence GGTCTGGGGCCACGTAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081536737_1081536749 2 Left 1081536737 11:44002168-44002190 CCTGTGTTACGTGGCCCCAGACC No data
Right 1081536749 11:44002193-44002215 CGGAAAGGGCCATTCTGGTGGGG No data
1081536737_1081536750 3 Left 1081536737 11:44002168-44002190 CCTGTGTTACGTGGCCCCAGACC No data
Right 1081536750 11:44002194-44002216 GGAAAGGGCCATTCTGGTGGGGG No data
1081536737_1081536746 0 Left 1081536737 11:44002168-44002190 CCTGTGTTACGTGGCCCCAGACC No data
Right 1081536746 11:44002191-44002213 ACCGGAAAGGGCCATTCTGGTGG No data
1081536737_1081536753 14 Left 1081536737 11:44002168-44002190 CCTGTGTTACGTGGCCCCAGACC No data
Right 1081536753 11:44002205-44002227 TTCTGGTGGGGGACAGGAGAAGG No data
1081536737_1081536754 15 Left 1081536737 11:44002168-44002190 CCTGTGTTACGTGGCCCCAGACC No data
Right 1081536754 11:44002206-44002228 TCTGGTGGGGGACAGGAGAAGGG No data
1081536737_1081536755 16 Left 1081536737 11:44002168-44002190 CCTGTGTTACGTGGCCCCAGACC No data
Right 1081536755 11:44002207-44002229 CTGGTGGGGGACAGGAGAAGGGG No data
1081536737_1081536751 8 Left 1081536737 11:44002168-44002190 CCTGTGTTACGTGGCCCCAGACC No data
Right 1081536751 11:44002199-44002221 GGGCCATTCTGGTGGGGGACAGG No data
1081536737_1081536757 20 Left 1081536737 11:44002168-44002190 CCTGTGTTACGTGGCCCCAGACC No data
Right 1081536757 11:44002211-44002233 TGGGGGACAGGAGAAGGGGTGGG No data
1081536737_1081536756 19 Left 1081536737 11:44002168-44002190 CCTGTGTTACGTGGCCCCAGACC No data
Right 1081536756 11:44002210-44002232 GTGGGGGACAGGAGAAGGGGTGG No data
1081536737_1081536744 -3 Left 1081536737 11:44002168-44002190 CCTGTGTTACGTGGCCCCAGACC No data
Right 1081536744 11:44002188-44002210 ACCACCGGAAAGGGCCATTCTGG No data
1081536737_1081536748 1 Left 1081536737 11:44002168-44002190 CCTGTGTTACGTGGCCCCAGACC No data
Right 1081536748 11:44002192-44002214 CCGGAAAGGGCCATTCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081536737 Original CRISPR GGTCTGGGGCCACGTAACAC AGG (reversed) Intergenic