ID: 1081536738

View in Genome Browser
Species Human (GRCh38)
Location 11:44002173-44002195
Sequence GTTACGTGGCCCCAGACCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081536733_1081536738 -8 Left 1081536733 11:44002158-44002180 CCTCCTTCCTCCTGTGTTACGTG No data
Right 1081536738 11:44002173-44002195 GTTACGTGGCCCCAGACCACCGG No data
1081536728_1081536738 21 Left 1081536728 11:44002129-44002151 CCCTGCTCCTGAGCCAAGGTGAA No data
Right 1081536738 11:44002173-44002195 GTTACGTGGCCCCAGACCACCGG No data
1081536726_1081536738 28 Left 1081536726 11:44002122-44002144 CCTTTGTCCCTGCTCCTGAGCCA No data
Right 1081536738 11:44002173-44002195 GTTACGTGGCCCCAGACCACCGG No data
1081536729_1081536738 20 Left 1081536729 11:44002130-44002152 CCTGCTCCTGAGCCAAGGTGAAA No data
Right 1081536738 11:44002173-44002195 GTTACGTGGCCCCAGACCACCGG No data
1081536731_1081536738 14 Left 1081536731 11:44002136-44002158 CCTGAGCCAAGGTGAAACAGGTC No data
Right 1081536738 11:44002173-44002195 GTTACGTGGCCCCAGACCACCGG No data
1081536732_1081536738 8 Left 1081536732 11:44002142-44002164 CCAAGGTGAAACAGGTCCTCCTT No data
Right 1081536738 11:44002173-44002195 GTTACGTGGCCCCAGACCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081536738 Original CRISPR GTTACGTGGCCCCAGACCAC CGG Intergenic