ID: 1081536739

View in Genome Browser
Species Human (GRCh38)
Location 11:44002178-44002200
Sequence GTGGCCCCAGACCACCGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081536736_1081536739 -10 Left 1081536736 11:44002165-44002187 CCTCCTGTGTTACGTGGCCCCAG No data
Right 1081536739 11:44002178-44002200 GTGGCCCCAGACCACCGGAAAGG No data
1081536731_1081536739 19 Left 1081536731 11:44002136-44002158 CCTGAGCCAAGGTGAAACAGGTC No data
Right 1081536739 11:44002178-44002200 GTGGCCCCAGACCACCGGAAAGG No data
1081536735_1081536739 -6 Left 1081536735 11:44002161-44002183 CCTTCCTCCTGTGTTACGTGGCC No data
Right 1081536739 11:44002178-44002200 GTGGCCCCAGACCACCGGAAAGG No data
1081536733_1081536739 -3 Left 1081536733 11:44002158-44002180 CCTCCTTCCTCCTGTGTTACGTG No data
Right 1081536739 11:44002178-44002200 GTGGCCCCAGACCACCGGAAAGG No data
1081536728_1081536739 26 Left 1081536728 11:44002129-44002151 CCCTGCTCCTGAGCCAAGGTGAA No data
Right 1081536739 11:44002178-44002200 GTGGCCCCAGACCACCGGAAAGG No data
1081536729_1081536739 25 Left 1081536729 11:44002130-44002152 CCTGCTCCTGAGCCAAGGTGAAA No data
Right 1081536739 11:44002178-44002200 GTGGCCCCAGACCACCGGAAAGG No data
1081536732_1081536739 13 Left 1081536732 11:44002142-44002164 CCAAGGTGAAACAGGTCCTCCTT No data
Right 1081536739 11:44002178-44002200 GTGGCCCCAGACCACCGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081536739 Original CRISPR GTGGCCCCAGACCACCGGAA AGG Intergenic
No off target data available for this crispr