ID: 1081536740

View in Genome Browser
Species Human (GRCh38)
Location 11:44002179-44002201
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081536729_1081536740 26 Left 1081536729 11:44002130-44002152 CCTGCTCCTGAGCCAAGGTGAAA No data
Right 1081536740 11:44002179-44002201 TGGCCCCAGACCACCGGAAAGGG No data
1081536732_1081536740 14 Left 1081536732 11:44002142-44002164 CCAAGGTGAAACAGGTCCTCCTT No data
Right 1081536740 11:44002179-44002201 TGGCCCCAGACCACCGGAAAGGG No data
1081536728_1081536740 27 Left 1081536728 11:44002129-44002151 CCCTGCTCCTGAGCCAAGGTGAA No data
Right 1081536740 11:44002179-44002201 TGGCCCCAGACCACCGGAAAGGG No data
1081536735_1081536740 -5 Left 1081536735 11:44002161-44002183 CCTTCCTCCTGTGTTACGTGGCC No data
Right 1081536740 11:44002179-44002201 TGGCCCCAGACCACCGGAAAGGG No data
1081536731_1081536740 20 Left 1081536731 11:44002136-44002158 CCTGAGCCAAGGTGAAACAGGTC No data
Right 1081536740 11:44002179-44002201 TGGCCCCAGACCACCGGAAAGGG No data
1081536733_1081536740 -2 Left 1081536733 11:44002158-44002180 CCTCCTTCCTCCTGTGTTACGTG No data
Right 1081536740 11:44002179-44002201 TGGCCCCAGACCACCGGAAAGGG No data
1081536736_1081536740 -9 Left 1081536736 11:44002165-44002187 CCTCCTGTGTTACGTGGCCCCAG No data
Right 1081536740 11:44002179-44002201 TGGCCCCAGACCACCGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081536740 Original CRISPR TGGCCCCAGACCACCGGAAA GGG Intergenic