ID: 1081536747

View in Genome Browser
Species Human (GRCh38)
Location 11:44002192-44002214
Sequence CCCACCAGAATGGCCCTTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081536747_1081536753 -10 Left 1081536747 11:44002192-44002214 CCGGAAAGGGCCATTCTGGTGGG No data
Right 1081536753 11:44002205-44002227 TTCTGGTGGGGGACAGGAGAAGG No data
1081536747_1081536757 -4 Left 1081536747 11:44002192-44002214 CCGGAAAGGGCCATTCTGGTGGG No data
Right 1081536757 11:44002211-44002233 TGGGGGACAGGAGAAGGGGTGGG No data
1081536747_1081536756 -5 Left 1081536747 11:44002192-44002214 CCGGAAAGGGCCATTCTGGTGGG No data
Right 1081536756 11:44002210-44002232 GTGGGGGACAGGAGAAGGGGTGG No data
1081536747_1081536755 -8 Left 1081536747 11:44002192-44002214 CCGGAAAGGGCCATTCTGGTGGG No data
Right 1081536755 11:44002207-44002229 CTGGTGGGGGACAGGAGAAGGGG No data
1081536747_1081536754 -9 Left 1081536747 11:44002192-44002214 CCGGAAAGGGCCATTCTGGTGGG No data
Right 1081536754 11:44002206-44002228 TCTGGTGGGGGACAGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081536747 Original CRISPR CCCACCAGAATGGCCCTTTC CGG (reversed) Intergenic