ID: 1081536750

View in Genome Browser
Species Human (GRCh38)
Location 11:44002194-44002216
Sequence GGAAAGGGCCATTCTGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081536736_1081536750 6 Left 1081536736 11:44002165-44002187 CCTCCTGTGTTACGTGGCCCCAG No data
Right 1081536750 11:44002194-44002216 GGAAAGGGCCATTCTGGTGGGGG No data
1081536732_1081536750 29 Left 1081536732 11:44002142-44002164 CCAAGGTGAAACAGGTCCTCCTT No data
Right 1081536750 11:44002194-44002216 GGAAAGGGCCATTCTGGTGGGGG No data
1081536733_1081536750 13 Left 1081536733 11:44002158-44002180 CCTCCTTCCTCCTGTGTTACGTG No data
Right 1081536750 11:44002194-44002216 GGAAAGGGCCATTCTGGTGGGGG No data
1081536735_1081536750 10 Left 1081536735 11:44002161-44002183 CCTTCCTCCTGTGTTACGTGGCC No data
Right 1081536750 11:44002194-44002216 GGAAAGGGCCATTCTGGTGGGGG No data
1081536737_1081536750 3 Left 1081536737 11:44002168-44002190 CCTGTGTTACGTGGCCCCAGACC No data
Right 1081536750 11:44002194-44002216 GGAAAGGGCCATTCTGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081536750 Original CRISPR GGAAAGGGCCATTCTGGTGG GGG Intergenic
No off target data available for this crispr