ID: 1081536751

View in Genome Browser
Species Human (GRCh38)
Location 11:44002199-44002221
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081536743_1081536751 -8 Left 1081536743 11:44002184-44002206 CCAGACCACCGGAAAGGGCCATT No data
Right 1081536751 11:44002199-44002221 GGGCCATTCTGGTGGGGGACAGG No data
1081536741_1081536751 -6 Left 1081536741 11:44002182-44002204 CCCCAGACCACCGGAAAGGGCCA No data
Right 1081536751 11:44002199-44002221 GGGCCATTCTGGTGGGGGACAGG No data
1081536742_1081536751 -7 Left 1081536742 11:44002183-44002205 CCCAGACCACCGGAAAGGGCCAT No data
Right 1081536751 11:44002199-44002221 GGGCCATTCTGGTGGGGGACAGG No data
1081536737_1081536751 8 Left 1081536737 11:44002168-44002190 CCTGTGTTACGTGGCCCCAGACC No data
Right 1081536751 11:44002199-44002221 GGGCCATTCTGGTGGGGGACAGG No data
1081536735_1081536751 15 Left 1081536735 11:44002161-44002183 CCTTCCTCCTGTGTTACGTGGCC No data
Right 1081536751 11:44002199-44002221 GGGCCATTCTGGTGGGGGACAGG No data
1081536736_1081536751 11 Left 1081536736 11:44002165-44002187 CCTCCTGTGTTACGTGGCCCCAG No data
Right 1081536751 11:44002199-44002221 GGGCCATTCTGGTGGGGGACAGG No data
1081536733_1081536751 18 Left 1081536733 11:44002158-44002180 CCTCCTTCCTCCTGTGTTACGTG No data
Right 1081536751 11:44002199-44002221 GGGCCATTCTGGTGGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081536751 Original CRISPR GGGCCATTCTGGTGGGGGAC AGG Intergenic