ID: 1081541553

View in Genome Browser
Species Human (GRCh38)
Location 11:44038278-44038300
Sequence GGACAGAGTAGCCCAGACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081541549_1081541553 17 Left 1081541549 11:44038238-44038260 CCTTGAAGGAGATGAGGGAGTGA No data
Right 1081541553 11:44038278-44038300 GGACAGAGTAGCCCAGACGCTGG No data
1081541552_1081541553 -7 Left 1081541552 11:44038262-44038284 CCAAGCAGGTATCTGAGGACAGA No data
Right 1081541553 11:44038278-44038300 GGACAGAGTAGCCCAGACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081541553 Original CRISPR GGACAGAGTAGCCCAGACGC TGG Intergenic
No off target data available for this crispr