ID: 1081547282

View in Genome Browser
Species Human (GRCh38)
Location 11:44080369-44080391
Sequence CTTGAGGAGTTGATGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 198}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081547272_1081547282 24 Left 1081547272 11:44080322-44080344 CCAGCCAAGCCCTTTCCATTAGC 0: 1
1: 0
2: 2
3: 15
4: 136
Right 1081547282 11:44080369-44080391 CTTGAGGAGTTGATGGAGCATGG 0: 1
1: 0
2: 0
3: 15
4: 198
1081547275_1081547282 14 Left 1081547275 11:44080332-44080354 CCTTTCCATTAGCCTTCTCTTCT 0: 1
1: 0
2: 6
3: 55
4: 542
Right 1081547282 11:44080369-44080391 CTTGAGGAGTTGATGGAGCATGG 0: 1
1: 0
2: 0
3: 15
4: 198
1081547273_1081547282 20 Left 1081547273 11:44080326-44080348 CCAAGCCCTTTCCATTAGCCTTC 0: 1
1: 0
2: 2
3: 12
4: 268
Right 1081547282 11:44080369-44080391 CTTGAGGAGTTGATGGAGCATGG 0: 1
1: 0
2: 0
3: 15
4: 198
1081547274_1081547282 15 Left 1081547274 11:44080331-44080353 CCCTTTCCATTAGCCTTCTCTTC 0: 1
1: 0
2: 6
3: 45
4: 572
Right 1081547282 11:44080369-44080391 CTTGAGGAGTTGATGGAGCATGG 0: 1
1: 0
2: 0
3: 15
4: 198
1081547277_1081547282 2 Left 1081547277 11:44080344-44080366 CCTTCTCTTCTTGTCCTCACAAA 0: 1
1: 0
2: 5
3: 56
4: 648
Right 1081547282 11:44080369-44080391 CTTGAGGAGTTGATGGAGCATGG 0: 1
1: 0
2: 0
3: 15
4: 198
1081547271_1081547282 25 Left 1081547271 11:44080321-44080343 CCCAGCCAAGCCCTTTCCATTAG 0: 1
1: 0
2: 0
3: 12
4: 183
Right 1081547282 11:44080369-44080391 CTTGAGGAGTTGATGGAGCATGG 0: 1
1: 0
2: 0
3: 15
4: 198
1081547276_1081547282 9 Left 1081547276 11:44080337-44080359 CCATTAGCCTTCTCTTCTTGTCC 0: 1
1: 0
2: 3
3: 32
4: 409
Right 1081547282 11:44080369-44080391 CTTGAGGAGTTGATGGAGCATGG 0: 1
1: 0
2: 0
3: 15
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081547282 Original CRISPR CTTGAGGAGTTGATGGAGCA TGG Intronic
901098811 1:6703347-6703369 CTGGAAGAGCTGATGGACCATGG - Intergenic
902709530 1:18229196-18229218 CTGGAGGAAGTGATGGAGCATGG + Intronic
903299011 1:22364795-22364817 CTTGAGGATTAAATGAAGCAAGG - Intergenic
903432893 1:23321759-23321781 CTTGGTGAGTTGATGAAGCAGGG - Intronic
904091280 1:27946637-27946659 CTGCAGGAGGTGGTGGAGCAGGG + Intronic
904274437 1:29371068-29371090 CTTGTCTAGCTGATGGAGCAGGG - Intergenic
904466029 1:30708004-30708026 CCAGAGGATTTGCTGGAGCAGGG - Intergenic
904600360 1:31669511-31669533 CTTGAGGGGATGAGGGAGAAGGG - Intronic
905961695 1:42048292-42048314 CTTCAGCAGAGGATGGAGCAAGG + Intergenic
906516295 1:46440727-46440749 CTTGAGGGGCTGCTGGAGCTGGG + Intergenic
907223582 1:52924999-52925021 CTTGAGGAGCTGAGGCAGAAAGG - Intronic
907648437 1:56267967-56267989 GTGGAGGGGTTGATGAAGCAAGG + Intergenic
910350275 1:86288499-86288521 CTAGATGACTTTATGGAGCATGG + Intergenic
913292769 1:117290165-117290187 GGTGAGGAGGTGATGGTGCAGGG - Intergenic
913500833 1:119471269-119471291 CCTGAGGAGGAGATGGAGCAAGG + Intergenic
914000421 1:143690014-143690036 AGTGAGGAGTTTATGTAGCAGGG - Intergenic
915883770 1:159701582-159701604 CTTGAGGGTGAGATGGAGCAGGG + Intergenic
917826405 1:178825892-178825914 CTGGAGGATTTTAGGGAGCAGGG + Intronic
919305246 1:195824307-195824329 ATTGAGGAATTGATAGAGGATGG - Intergenic
920200690 1:204258035-204258057 CTTGGGGAGTTGTTTGAGGAGGG - Intronic
920977125 1:210796821-210796843 CTTGGGGAGTGGATTGAGTAGGG - Intronic
921276861 1:213529273-213529295 AATGAGAAGTTTATGGAGCATGG + Intergenic
922797508 1:228347887-228347909 TGTGAGGAGGTGATGGAGCTAGG + Intronic
923204120 1:231741621-231741643 CTTAGGGAGCTGGTGGAGCAGGG + Intronic
1064985674 10:21207642-21207664 CTGCAGGAGATCATGGAGCAGGG + Intergenic
1065645621 10:27831048-27831070 CTGGAGGAGTGGATGGGGGAGGG + Intronic
1069039995 10:63685429-63685451 CTGGAGGAGTCGGTGGACCAGGG - Intergenic
1070773514 10:79096642-79096664 CTTGAGGGGTTGATAGAGACTGG + Intronic
1072798349 10:98374068-98374090 CTTCAGGGGCTGAGGGAGCATGG - Intergenic
1074290257 10:112132943-112132965 ACTGAGGAATTGATGGAGAAAGG - Intergenic
1077774006 11:5251589-5251611 CTTTATGATTTGATGGAGCCAGG + Intronic
1079022144 11:16917852-16917874 CTTTAGGACTACATGGAGCATGG - Intronic
1079709669 11:23666053-23666075 CTTGGGAAGTAGATGGGGCAGGG + Intergenic
1081547282 11:44080369-44080391 CTTGAGGAGTTGATGGAGCATGG + Intronic
1082192349 11:49261799-49261821 ATGGAGGAGTAGGTGGAGCACGG - Intergenic
1083725389 11:64625338-64625360 TTTGAGGAGTTCATGGCGGATGG - Intronic
1085411270 11:76292108-76292130 CTTGGGGACTGGAGGGAGCAGGG - Intergenic
1087016106 11:93555843-93555865 CTAGGGGAGATGATGCAGCAGGG - Intergenic
1087066161 11:94029896-94029918 CTTGTGGAGGTGATGGAGAAAGG + Intronic
1091822552 12:3487148-3487170 CATGAGGTGGTGATGGATCATGG + Intronic
1093079622 12:14794627-14794649 CTTGAGGAGGAGGTGGACCAGGG + Exonic
1093151909 12:15631601-15631623 TTGGAGGAGGTGATGGAGCAGGG + Exonic
1098554124 12:71799299-71799321 CTGGAAGGGTTGAAGGAGCAGGG - Exonic
1098688104 12:73451214-73451236 CTGGAGGAGTTCATGGGGCCAGG + Intergenic
1099596175 12:84669260-84669282 TTTGAGAAGGTGATGGAGTATGG - Intergenic
1102026616 12:109717393-109717415 CTTGGGATGTAGATGGAGCAAGG + Intronic
1102843934 12:116157460-116157482 CTTGAGGAGTTTAGGGAAGAGGG - Intronic
1103211347 12:119169007-119169029 CTTAAGGACATGGTGGAGCAGGG + Intergenic
1103961969 12:124614540-124614562 CTTGAGGAAGTGAGGGAGCGTGG - Intergenic
1105821986 13:24087966-24087988 CTGGAGGAGATGCTGGAGGAAGG - Intronic
1106316386 13:28597779-28597801 CTTTAGGAAATGATGGAGCCAGG + Intergenic
1108280890 13:48860521-48860543 ATTGAGGAGTTAATGTATCAAGG - Intergenic
1111329568 13:86746909-86746931 CTAGAAGAGTTGAAGGAGCCAGG - Intergenic
1112661175 13:101510154-101510176 CTAGAGGAGGGGATGGAGGAAGG - Intronic
1113164993 13:107430444-107430466 GTTGTGGAGTGGAGGGAGCAGGG - Intronic
1117119850 14:52554580-52554602 CTTGAGGAGGGGAGGAAGCAAGG + Intronic
1117273130 14:54165574-54165596 CTTGAGGAGTTGAGGAAGTTAGG - Intergenic
1117845448 14:59906755-59906777 CTTGAGGAATTGATAGAAGATGG - Intergenic
1118485402 14:66210037-66210059 ATTGTGGACTTGTTGGAGCAGGG - Intergenic
1121115391 14:91339389-91339411 CTGGAGGACTTGATGGGGCTGGG + Exonic
1122408737 14:101515247-101515269 CTTGCGGAGTGGGTGGAGAAGGG - Intergenic
1122449843 14:101796839-101796861 CTTGAGGAGCAGAGGCAGCAGGG - Intronic
1122646007 14:103194666-103194688 CTTGTGGAGTAGATGGAGGAAGG + Intergenic
1122760767 14:104023731-104023753 TCTGAGGAGTTGGTGGAGGAAGG + Intronic
1125894176 15:43288061-43288083 CTGGAGGACTTGAAGAAGCAGGG + Intronic
1130622277 15:85476132-85476154 CTTGAGGACTGGACTGAGCATGG + Intronic
1132153061 15:99475884-99475906 CTTGTGGAGGTGGTGGGGCAAGG - Intergenic
1132679789 16:1134989-1135011 CAGAAGGAGTTGATGGAGCACGG - Intergenic
1136135585 16:28255211-28255233 CTTGAGGAGTTGAAGGAATCTGG - Intergenic
1141070403 16:80949101-80949123 CTTGAGAAGTTGGTGGGTCAGGG + Intergenic
1143041745 17:4043244-4043266 CTAGAGGTGTTTCTGGAGCATGG + Intronic
1146510098 17:33439535-33439557 CTTGGGGAGCTGAAGAAGCAGGG - Intronic
1148044588 17:44735240-44735262 GTTGAGGAGAAGCTGGAGCAGGG - Intronic
1148757956 17:49984433-49984455 CTGGAGGATTAGCTGGAGCAGGG - Intergenic
1149042846 17:52210932-52210954 CTAGGAGATTTGATGGAGCATGG + Intergenic
1149557520 17:57584653-57584675 CTTGAGAACTTGTTGGAGAAAGG + Intronic
1150228861 17:63538977-63538999 CTTGGGGAGTTTAGGGAGAAAGG + Intronic
1150569564 17:66374198-66374220 GTTGAGGAGGTGGTGGAGGAAGG - Intronic
1151996580 17:77613150-77613172 CTCCAGGAGGTGATGGAGAAGGG + Intergenic
1153332575 18:3889013-3889035 CTTCAGGAGGTGCTGCAGCAGGG + Intronic
1153339684 18:3961168-3961190 CCTGAGGAGTTCACTGAGCAAGG + Intronic
1155165738 18:23230973-23230995 CTTGGGGTGCTGATGGTGCAAGG + Intronic
1155249638 18:23942367-23942389 CTTGAGTGGTTTATGGTGCAGGG - Intronic
1156012633 18:32512455-32512477 CTTGAGGAGGGGGTGGACCAGGG - Intergenic
1159556804 18:69954509-69954531 CTTTAGGATTTGAGGCAGCACGG - Intronic
1160334712 18:78028519-78028541 CTAGAGGAATTGTTGGATCAAGG - Intergenic
1161443206 19:4304201-4304223 CTGGAGGAGCTGTTGGAGCCTGG + Intergenic
1162090136 19:8274189-8274211 GTGGAGGAGTTGGTGGAGAAGGG - Intronic
1162092370 19:8289052-8289074 GTGGAGGAGTTGGTGGAGAAGGG - Intronic
1162525612 19:11204428-11204450 CTGGAGGAGGTGATGGAGGGTGG - Intronic
1167724017 19:51198994-51199016 TTTGAGGAGAAGATGGAGCAGGG - Intergenic
925671752 2:6317488-6317510 CTTCAGGATTTCAGGGAGCATGG + Intergenic
926139145 2:10358082-10358104 CTGGAGGAGTTGCTGGAAGAAGG + Intronic
929558966 2:42943723-42943745 CTGGAGAAGTTGATGGGGCTTGG + Intergenic
930929672 2:56866273-56866295 CTTGATGAGTTTATGGACCTGGG + Intergenic
931489187 2:62725731-62725753 CATGGGCAGCTGATGGAGCAAGG + Intronic
932705208 2:74019460-74019482 CATGAGGACTTGAGGGAGAAAGG - Intronic
934124231 2:88870837-88870859 CTTGAGGGGTGGCTGGGGCAGGG + Intergenic
935942375 2:108254197-108254219 CCTGGGGAGGAGATGGAGCAGGG - Intronic
936432935 2:112480744-112480766 CAGGAGGAATTGATGCAGCATGG + Intergenic
936463404 2:112727291-112727313 CTTAAGAGGTGGATGGAGCAGGG + Intronic
936997965 2:118435167-118435189 CTTGAGGAGTGGTTGGAGGAGGG + Intergenic
939620444 2:144412387-144412409 TTAGAGGAGTTGATGAAGTAAGG + Intronic
943516255 2:188890927-188890949 CTTGAGGGGTTGATGGGACTGGG - Intergenic
944638184 2:201695122-201695144 CCTGAGGACTTCGTGGAGCAAGG - Intronic
947710310 2:232309882-232309904 CTTGAGGAGGGGACAGAGCAGGG + Intronic
948599373 2:239099713-239099735 CTTGGGGAGAAGATGGCGCATGG - Intronic
948744712 2:240080204-240080226 CCTGTGGAGTCCATGGAGCAGGG + Intergenic
1170006919 20:11679355-11679377 CTTGAGGGGTTGATGAAACCTGG - Intergenic
1170182615 20:13549208-13549230 CTTGAGGAGTGGAGGGAATAGGG - Intronic
1170816689 20:19720277-19720299 GATGAGGACTTGATGGGGCAGGG + Intronic
1172189595 20:33053943-33053965 CTTGTGGAGCTGCAGGAGCAAGG + Intergenic
1172979286 20:38928706-38928728 CGTGAGGAGGGGATGGAGCCAGG + Intronic
1173373576 20:42461840-42461862 CTTGAGGAGAAGATAGAGCTGGG + Intronic
1173628925 20:44495290-44495312 CTTGAGGGGTAACTGGAGCACGG + Intergenic
1175521879 20:59607039-59607061 CTTGGGAACTTGATGGAGGAAGG + Intronic
1175541041 20:59747814-59747836 CTGCTGGAGATGATGGAGCAGGG + Exonic
1175711094 20:61221681-61221703 CTTGATGTGTTGCTGGAACAAGG + Intergenic
1176911075 21:14565769-14565791 GTTGAGAAGTTTATGTAGCATGG - Intronic
1177484501 21:21739728-21739750 GGTGAGAAGTTGATGGAGAAAGG + Intergenic
1178218587 21:30629122-30629144 GTGGGGGAGTTGATGTAGCAGGG + Intergenic
1182740443 22:32563608-32563630 CTGGAAAAGTTGATGGATCAGGG + Intronic
1183216314 22:36482215-36482237 GAAGAGGAGGTGATGGAGCAGGG + Intergenic
1183787439 22:40038282-40038304 CCTGAGGAGTGAATGGAGGAGGG + Exonic
949758588 3:7442588-7442610 CTTAAGGAGGTGAAGGGGCATGG + Intronic
949928684 3:9061316-9061338 CTTGAGAAGTGGATGGGACAAGG - Intronic
950526804 3:13529067-13529089 AGTGAGGAGTAGCTGGAGCAGGG - Intergenic
950628652 3:14267017-14267039 TTTGAGGAGTGGAGGGAGGAAGG + Intergenic
953695453 3:45154877-45154899 TTTGAGGAGGTGATGGTGCATGG - Intergenic
958447490 3:94233348-94233370 CTTGTGGAGGTGATGTTGCATGG + Intergenic
962089040 3:132223474-132223496 GTTGAGGAGTTAATGCACCATGG - Intronic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
962820971 3:139047080-139047102 GTTGAGGAGTTCATGAAGCCCGG + Intronic
962847102 3:139282375-139282397 CTTGAGGAGATGATGGAGGGAGG + Intronic
963533315 3:146497637-146497659 CTTGAGCAGTTGATGGGACTGGG - Intergenic
964890395 3:161527623-161527645 CTTGAGGATAAGATGGAGAAGGG + Intergenic
965599821 3:170443421-170443443 CTTGATGAGATTATGGGGCAAGG - Intronic
967430116 3:189373982-189374004 GTTGAGGAATTGATGGTTCAAGG - Intergenic
971157943 4:24103273-24103295 GTTGAGGAGCTGATTGAGAAGGG - Intergenic
971522007 4:27565438-27565460 CTTGAGTAGGTGAGGGAGAATGG - Intergenic
971940601 4:33210092-33210114 TTTGGGGACTTGATGGAGAAGGG + Intergenic
975294576 4:72718144-72718166 CTGGGGGAGTTGAAGGAGAATGG + Intergenic
975840886 4:78472547-78472569 ATTTAGGAGTTGAGGAAGCACGG - Intronic
979372727 4:119908313-119908335 CTTGATGCCTTGATGGAGCCTGG + Intergenic
984305099 4:177979404-177979426 CAAGAGGAGTTGAGGGAACATGG + Intronic
989129630 5:38093800-38093822 CTTGTGGAGATGGGGGAGCAAGG + Intergenic
990706990 5:58541120-58541142 CTTGACGAGTTGAGAGAGGAAGG - Intergenic
991141622 5:63250755-63250777 CTAGCAGAGTTGAAGGAGCATGG - Intergenic
991696109 5:69274389-69274411 CTTTGGGAGGTGAAGGAGCAAGG + Intronic
992168559 5:74078707-74078729 CTTGAGGAGTTGATGTAACCAGG + Intergenic
992894130 5:81232515-81232537 TCAGAGGACTTGATGGAGCAAGG - Intergenic
995434363 5:112119260-112119282 CATAATGAGTTGATGGAGGAGGG + Intergenic
996059525 5:119017753-119017775 CTTTGGGAGGTGATGGAGGAGGG + Intergenic
996500869 5:124214311-124214333 TTTGACGAGTTGAGGGAGGAAGG + Intergenic
997241710 5:132312591-132312613 CCTGAGGTGGTGGTGGAGCAGGG - Intronic
999264602 5:150258123-150258145 TCTGAGGAGATAATGGAGCATGG + Intronic
999834230 5:155352284-155352306 CTTCAGGAGTTGCTGGGGGATGG - Intergenic
1001743669 5:174073457-174073479 CATGAGGACTTGGTGGAGAAAGG + Intronic
1004895604 6:20144843-20144865 CTTGAGGGGTAGGTGGAGGAAGG - Intronic
1005199398 6:23326061-23326083 CTTGAGGATTTGATGGGGGTTGG - Intergenic
1005501440 6:26432049-26432071 CTTGAGGTCCTGATTGAGCAAGG + Intergenic
1007354977 6:41308051-41308073 CCTGAGAACTTCATGGAGCATGG - Intergenic
1007947541 6:45839717-45839739 CTGCAGGAGGTGATGGAGCAGGG - Intergenic
1008096797 6:47347181-47347203 CTGGAGGAGGTGATGGTGCTGGG + Intergenic
1008124649 6:47654636-47654658 ATGGAGGAGTTGATGGAGGCTGG - Intergenic
1008271437 6:49494949-49494971 CTAGTGGAGCAGATGGAGCAGGG + Intergenic
1010323740 6:74541752-74541774 CTTCAGGATTTTATGGAACATGG - Intergenic
1010989901 6:82468992-82469014 AATTAGGAGTTGATGTAGCAGGG - Intergenic
1011009118 6:82683875-82683897 CTTGAGGAATTGATGTTGAAAGG - Intergenic
1012518690 6:100093610-100093632 CTTGAGCACTTGCTGGAGCAGGG + Intergenic
1012849771 6:104432463-104432485 CTTGAAGAGTAGAAGGATCAAGG + Intergenic
1013862870 6:114657929-114657951 CTTGGGGAGTGTATGTAGCATGG + Intergenic
1016700976 6:147053861-147053883 TTAGAAGAGTAGATGGAGCATGG - Intergenic
1017028876 6:150203656-150203678 CATGAGCAGTTGATAGTGCAGGG + Intronic
1021486698 7:21175717-21175739 CTTGGGAAGCTGATGGAGAAGGG + Intergenic
1021612810 7:22474659-22474681 CTTGGTGAGATGCTGGAGCAGGG + Intronic
1022100719 7:27167409-27167431 CTAGAGGAATTTATGGGGCAAGG - Intronic
1030479929 7:110090456-110090478 CGTGAGTATTTGATGGAGAAGGG - Intergenic
1031435135 7:121724320-121724342 TTTGAGGAGTTGAGGGAAGAAGG - Intergenic
1032563860 7:132920084-132920106 CATGAGTAGTCCATGGAGCAGGG + Intronic
1034161992 7:149000856-149000878 TTTGAGGATATGATGGAGGAAGG - Intergenic
1036487235 8:9190237-9190259 CTTGAGGAAAGGATGGAGGATGG - Intergenic
1037425552 8:18751055-18751077 CTTGGGCAGTTGATGGACCTGGG + Intronic
1040077746 8:43256851-43256873 TTTGAGGAGTTTCTGGAGTAGGG + Intergenic
1041080751 8:54212761-54212783 CTTGAGGATTTCATGGAGCCAGG - Intergenic
1041249100 8:55917531-55917553 CTTGTGGAGTGGAGGGAGTAGGG + Intronic
1041720052 8:60967534-60967556 CTTGAGGTGTGGGTGAAGCAGGG + Intergenic
1043858530 8:85289016-85289038 CATGAGGACTTGATGAAGGATGG - Intergenic
1043973927 8:86564093-86564115 CTGAAGGAGGTGAGGGAGCAAGG - Intronic
1046576897 8:116040903-116040925 CTTGAGGACTTGAAGTACCAAGG + Intergenic
1048346955 8:133583235-133583257 CTTGAGGGCTGGATGCAGCAGGG + Intergenic
1048601969 8:135928253-135928275 TTTGAGGAGTTGAAGGAGAGGGG + Intergenic
1051243708 9:15086849-15086871 CTTGAGGAACAGATGTAGCAAGG - Intergenic
1052304679 9:26993783-26993805 CTAGAGGTATGGATGGAGCAAGG - Exonic
1052345800 9:27408265-27408287 TCTGTGGAGTTGATGAAGCAGGG + Intronic
1052389559 9:27863203-27863225 CTTAAGCAGTAGATGGAGTAAGG - Intergenic
1053164826 9:35836901-35836923 TTTGAGAGGTTGATGGGGCAAGG + Intronic
1055472914 9:76631519-76631541 CTTGAGGAGGTGATGACTCAAGG - Intronic
1060112573 9:120917205-120917227 CTTGAACAGTTGCTGGAGAAAGG + Intronic
1060931649 9:127492836-127492858 TTTGAGCAGCTGCTGGAGCAGGG - Exonic
1062731547 9:138112947-138112969 CTTGGAGAGGTGAGGGAGCATGG + Intronic
1186921991 X:14292414-14292436 TTTTAGGAGATGATGGAGAAGGG + Intergenic
1186953397 X:14653559-14653581 GATGAGGAGTTGATGAAGAAAGG + Intronic
1186983623 X:14986030-14986052 CTTTAGGTGTAGTTGGAGCAGGG + Intergenic
1188753187 X:33928648-33928670 CAGGAGTAGTTGATGCAGCAAGG + Intergenic
1191063300 X:56320799-56320821 CTTGACGAGTTGAGAGAGGAAGG + Intergenic
1191067001 X:56358851-56358873 TTTGTGGAGTTGATGGAATAAGG + Intergenic
1191862562 X:65677922-65677944 CTTGAAGAGTTGCTCCAGCAGGG + Intronic
1192364050 X:70455970-70455992 CTTGAGGCACTGAAGGAGCATGG - Intronic
1196260804 X:113578586-113578608 CTTGAGGAATTGAAGAAACACGG + Intergenic
1198857842 X:141036612-141036634 CTTGAGGAGTAGATGTAATATGG - Intergenic
1198904854 X:141550760-141550782 CTTGAGGAGTAGATGTAATATGG + Intergenic
1200016380 X:153166850-153166872 ACTGATGAGTTCATGGAGCAGGG + Intergenic
1201728973 Y:17185619-17185641 CTTGGGCAGTTGATGGGACAGGG + Intergenic