ID: 1081549799

View in Genome Browser
Species Human (GRCh38)
Location 11:44100651-44100673
Sequence CCGCATCTCCTGCAGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 7, 3: 37, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081549793_1081549799 24 Left 1081549793 11:44100604-44100626 CCAGACATGAACTCAGGGTTCAT 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1081549799 11:44100651-44100673 CCGCATCTCCTGCAGCTGGAGGG 0: 1
1: 0
2: 7
3: 37
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081549799 Original CRISPR CCGCATCTCCTGCAGCTGGA GGG Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
900398882 1:2464776-2464798 TCTCATCTCTTTCAGCTGGAGGG - Intronic
900689203 1:3969692-3969714 CCTCATCTCTTGCAGCCAGAGGG - Intergenic
901474221 1:9478527-9478549 CCTCCTCTCCTCCATCTGGAAGG + Intergenic
901965617 1:12863567-12863589 CCCCTTCTCCTGCAGCTTGGGGG + Intronic
901981014 1:13033945-13033967 CCCCTTCTCCTGCAGCTTGGGGG + Intronic
902001073 1:13194985-13195007 CCCCTTCTCCTGCAGCTTGGGGG - Intergenic
902020304 1:13340689-13340711 CCCCTTCTCCTGCAGCTTGGGGG - Intergenic
902838834 1:19062823-19062845 CAGCCTCTCTTGCAGCTGCATGG + Intergenic
903544873 1:24117794-24117816 CCGCATACCCTGGAGCTGGCTGG - Intergenic
904329075 1:29746209-29746231 CTGCCCCTTCTGCAGCTGGAAGG + Intergenic
904773916 1:32895335-32895357 CCTCAGCTCCAGCAGCTGGTGGG + Exonic
904815324 1:33192065-33192087 CCTAATTTCCTACAGCTGGAGGG - Intergenic
907309247 1:53529945-53529967 CAGCCTCTCCTGCAGTTTGAAGG - Exonic
907461773 1:54609478-54609500 CAGCATGGCCTGCATCTGGAAGG + Exonic
907930096 1:58991036-58991058 TCTTATCTCCTGCAGTTGGAGGG - Intergenic
910070426 1:83207046-83207068 CTTCATCTCCTGCAACTAGAGGG + Intergenic
915205678 1:154268928-154268950 CACCATCACCTGCAGCAGGATGG + Exonic
915634798 1:157178507-157178529 CCGCTTCTGCTGCAGTAGGAGGG + Intergenic
917449942 1:175139491-175139513 CCGCATCTTGTCCCGCTGGAAGG + Intronic
917458191 1:175203901-175203923 CACCTTCTCTTGCAGCTGGAGGG - Intergenic
919235909 1:194842324-194842346 TCTCATCTGCTGAAGCTGGAGGG + Intergenic
922538635 1:226402322-226402344 CCACTTCTCCTGCTTCTGGAAGG - Exonic
922889084 1:229046635-229046657 CCGTACCTCCTGGAGCTGGCTGG + Intergenic
1062788454 10:285004-285026 CTGCTTCTCCGGCACCTGGAGGG - Intronic
1063698962 10:8366189-8366211 ACGCCTCTACTGCAGCTGGAAGG - Intergenic
1065885199 10:30070678-30070700 CGGCATATGCTGTAGCTGGAGGG - Intronic
1067042464 10:42962303-42962325 CCGCAGCTGCTGCATCAGGAGGG + Intergenic
1067180906 10:43985299-43985321 TCGCAGCTCCTCCACCTGGATGG + Intergenic
1069274727 10:66575601-66575623 CCCCATATCCTACAGCTGGTGGG + Intronic
1069511121 10:69043251-69043273 ACGCACCGCCAGCAGCTGGAAGG - Intergenic
1069560007 10:69422710-69422732 CCTCATCTCGTCCAGCTGGCAGG + Intergenic
1070302063 10:75210841-75210863 CTGCAGCTCCAGCAGCTGGAGGG - Exonic
1071303244 10:84273645-84273667 CTGCATCCCCTCCACCTGGATGG - Intergenic
1073817937 10:107228094-107228116 CCTCATCTTCTGTAGCTGAAGGG + Intergenic
1073818522 10:107234001-107234023 TCACATATCCTGCAGCTAGAAGG + Intergenic
1075608318 10:123832224-123832246 CTGCATCTCCTGCATCTGAACGG + Intronic
1075734569 10:124655996-124656018 CCCCATTGCCTGCTGCTGGATGG - Intronic
1076569789 10:131425143-131425165 CGCAATCACCTGCAGCTGGATGG - Intergenic
1078351101 11:10594187-10594209 CCCCATCTTCTGCAGCAGGAGGG + Exonic
1078625167 11:12948704-12948726 CCTCAGCCCATGCAGCTGGAGGG - Intergenic
1079347094 11:19662571-19662593 CCACATGTCAGGCAGCTGGAGGG + Intronic
1080408724 11:32003358-32003380 CCACATCTCCTGAAGCTGGGAGG + Intronic
1081549799 11:44100651-44100673 CCGCATCTCCTGCAGCTGGAGGG + Intronic
1082925970 11:58547645-58547667 CCTCGCCTCCTGCAGCTTGAAGG + Intronic
1083314644 11:61806923-61806945 CACCATGGCCTGCAGCTGGATGG + Intronic
1084273969 11:68042643-68042665 CCGCACCTCCTCCTGCAGGAAGG - Exonic
1088649408 11:111944146-111944168 CCTCATCTTCTGCTGCTGGAGGG + Intronic
1089416425 11:118296010-118296032 CCTCATCTCCTGCAGCTAGAGGG + Intergenic
1090385231 11:126354656-126354678 CTGCTTCTGCTGAAGCTGGAGGG - Intergenic
1090968254 11:131617016-131617038 CTCCAACTCCTGCATCTGGAGGG + Intronic
1091367038 11:135030954-135030976 CCTCATTTCCTGCATTTGGATGG + Intergenic
1092045344 12:5428525-5428547 TTGCATCTTCTGCTGCTGGAGGG - Intergenic
1092231638 12:6778837-6778859 GCGCATCTGCTGCAGCCGGAGGG - Intergenic
1095962367 12:47843807-47843829 CCGCATCTTCTCCATCTGGCAGG - Exonic
1096571824 12:52527763-52527785 CCACGTCTCATGCATCTGGAAGG - Intergenic
1101853703 12:108424790-108424812 CCTCATCTTCTGTAGCTGGAAGG - Intergenic
1101928255 12:108991157-108991179 GGGCATCCCTTGCAGCTGGAAGG + Intronic
1102510852 12:113414467-113414489 CTGCACCTGCTGCAGCAGGAAGG + Intronic
1105296881 13:19095496-19095518 TCTCCTCTCCTGCAGCAGGAGGG + Intergenic
1107558826 13:41542558-41542580 CCGCATCTCCTGCATCTGCCAGG - Intergenic
1108730796 13:53233599-53233621 CTGCAGCCCCTGCAGCTGAAGGG - Intergenic
1111452850 13:88441545-88441567 CCTTATCTCCTGCAGCTGCAGGG + Intergenic
1113709946 13:112456569-112456591 CCACATTCCCAGCAGCTGGAAGG + Intergenic
1113906552 13:113822016-113822038 CAGCCTCTCCTGCAGCTGCGCGG + Exonic
1115740197 14:36379289-36379311 TCTCATTTCCTACAGCTGGAGGG - Intergenic
1118329994 14:64807732-64807754 CCGCCTCTCCTGCCCTTGGAAGG - Intronic
1120368914 14:83607448-83607470 GGGCTTCTCCTGCACCTGGAAGG + Intergenic
1122305798 14:100765674-100765696 TCTCATCTCCTGCAGCTGGAGGG - Intergenic
1122602438 14:102928420-102928442 TTGCAGCTCCTGCCGCTGGATGG + Exonic
1122632595 14:103113850-103113872 CAGCATCCCCAGCGGCTGGAAGG + Intergenic
1122772699 14:104104380-104104402 CCGCAGCTCCTGCAGCAGGTCGG - Exonic
1123425698 15:20168759-20168781 CCGCTTCGCCTGCTGCTGAAAGG + Intergenic
1123534926 15:21175286-21175308 CCGCTTCGCCTGCTGCTGAAAGG + Intergenic
1123563621 15:21517580-21517602 CCACATCTCCTCCCACTGGAAGG - Intergenic
1123599873 15:21954868-21954890 CCACATCTCCTCCCACTGGAAGG - Intergenic
1125729217 15:41883348-41883370 CTGCAGCTCCTCCAGCTGGTGGG + Exonic
1125914720 15:43475598-43475620 CTGCATCTCCTGCAGCTCTCTGG - Exonic
1126222887 15:46235341-46235363 CCTTATCTCCTGCAGCCAGAAGG - Intergenic
1128523038 15:68388016-68388038 CCCCCTCCCCTGCACCTGGATGG + Intronic
1130517119 15:84633975-84633997 CCGCAGCTCCTTCTGCTGCAAGG + Intergenic
1130706669 15:86239462-86239484 CAGCCACTCCTGCAGCTGCAGGG + Intronic
1131430831 15:92387665-92387687 CCGCATCCCTTGCAGCTGGCGGG + Intergenic
1202971980 15_KI270727v1_random:244713-244735 CCACATCTCCTCCCACTGGAAGG - Intergenic
1132756743 16:1488939-1488961 CACCCTCTCCTGCGGCTGGAGGG - Intronic
1135422194 16:22313048-22313070 CCACATCCCTTGCAGCGGGAGGG + Intronic
1135612440 16:23880174-23880196 AGGCATCTCCTGCAGCAGAATGG - Intronic
1135923601 16:26672992-26673014 TCGCACCACCTGCAGCAGGATGG - Intergenic
1136132148 16:28229759-28229781 TAGCCCCTCCTGCAGCTGGATGG - Intergenic
1136858547 16:33680757-33680779 CCGCTTCACCTGCTGCTGAAAGG - Intergenic
1138427775 16:56947673-56947695 CCCTATCTCCTGTAGCTGCAGGG + Intergenic
1139443282 16:66979724-66979746 CCCCAACTCCAGCACCTGGAAGG - Intergenic
1139912641 16:70407609-70407631 CTGCATCTCCTGAGGATGGAAGG - Intronic
1141454826 16:84134195-84134217 CAGCATATCCAGCAGCAGGAGGG - Intronic
1141648676 16:85380781-85380803 CCGCTGCTCCTCCAGCTGAAGGG + Intergenic
1142149796 16:88507656-88507678 CCACATCTGCCGGAGCTGGATGG - Intronic
1142883200 17:2896787-2896809 CCTCATCTAATGCACCTGGAGGG + Intronic
1145065665 17:19759791-19759813 CCGCTTCTCCTCCAGCAGGCAGG - Intergenic
1146234601 17:31146540-31146562 TCTCCTCTCCTGCAGCAGGAGGG - Intronic
1146260372 17:31416669-31416691 CCCCTTCTCCTGCTGCTGCAGGG - Intronic
1146722001 17:35130376-35130398 CCGCATCTCCTCCGGCCCGATGG - Exonic
1147141859 17:38464828-38464850 CCGCATCTCTGCCAGCCGGAGGG + Intronic
1147325016 17:39665934-39665956 CAGCAGCTCCTGAAGCTGGATGG - Exonic
1147559938 17:41502526-41502548 CTGGATCTGCTGCAGCTGCAGGG + Exonic
1147948442 17:44093441-44093463 CAGCATCTCCTGCTGCTGCTTGG + Exonic
1148124820 17:45231222-45231244 CCGCAGCCCTTGAAGCTGGAGGG - Intronic
1148131428 17:45264668-45264690 CAGCTTCGCCTGGAGCTGGAGGG - Exonic
1148216627 17:45836997-45837019 CCGCAGCTCCTGCTGAGGGAGGG + Intergenic
1148388523 17:47253783-47253805 CCGCTTTTCCCGCAGCGGGAGGG - Intergenic
1148460393 17:47836355-47836377 CCACTTCTCCTGGACCTGGACGG + Exonic
1148779607 17:50113937-50113959 CCGCAGCTGCTGCAGCTGGACGG - Exonic
1149541404 17:57470732-57470754 CAGCAGCTCCTGCGGGTGGAAGG + Intronic
1152395269 17:80029146-80029168 TCGCAGCACCTGCAGCTGGCAGG + Intronic
1153457362 18:5295674-5295696 CCGCACATCCTGGAGCTGGCTGG + Intronic
1155740974 18:29287170-29287192 TTTCATCTCCTGCAGCTGGAGGG - Intergenic
1156482920 18:37447504-37447526 CTTCCTCTCCTGCAGCTGGAGGG + Intronic
1157599846 18:48887204-48887226 CTGCATCTGCTGCTGCTGGCAGG + Intergenic
1158158349 18:54451088-54451110 CAGCCTCCCTTGCAGCTGGATGG - Intergenic
1158180772 18:54712964-54712986 CCGCCTCTCCTGCAGGTGGATGG + Intergenic
1160546302 18:79658457-79658479 CCAAATCTCTTGCTGCTGGAGGG + Intergenic
1163678636 19:18668269-18668291 CTGCATCTCGTGCTGCCGGAAGG - Exonic
1163769457 19:19182067-19182089 CCCCATCTCCCCCAGCTGGCCGG + Intronic
1165049954 19:33134855-33134877 CCGCATCACCTGCAACCGGAAGG + Intronic
1165179296 19:33954060-33954082 CCGCATGGCTTGCAGCAGGAGGG - Intergenic
1167040669 19:47020992-47021014 CCGAGTCTCCTGCAGCGGGAGGG - Exonic
1167107344 19:47437965-47437987 CCCCATCCCCTGCAGCATGAGGG + Exonic
1167649386 19:50721151-50721173 CCGGAGAGCCTGCAGCTGGAGGG - Intergenic
1167815087 19:51873247-51873269 CCGCATTTGCTGCATCTGTAGGG + Exonic
1168503032 19:56909495-56909517 GAGGATCTCCTGCACCTGGAAGG - Intergenic
925027825 2:623521-623543 CCCCAGCGCCTGCAGCTGGTTGG - Intergenic
927191404 2:20519520-20519542 CTGCACCTCCTGTGGCTGGAGGG + Intergenic
927894397 2:26772075-26772097 CCACATCTCCAGGAGCTGGTGGG + Intronic
931688560 2:64815773-64815795 TAGCATCCCCTGCAGCTGAAGGG + Intergenic
931736999 2:65204986-65205008 CTGCAGCTGCAGCAGCTGGAGGG - Intergenic
931872925 2:66481106-66481128 CCTGATCCCCTGCAGCAGGAGGG + Intronic
932270328 2:70403510-70403532 CCTTTTCTTCTGCAGCTGGAAGG + Intergenic
932623019 2:73277228-73277250 CCTCAGCTCCAGCAGATGGAGGG - Intronic
932764777 2:74462643-74462665 GCCCTTCTCCTTCAGCTGGAAGG + Exonic
933942454 2:87255779-87255801 CCGCTTCTCCTGCTCCAGGAAGG - Intergenic
934544051 2:95199887-95199909 TTGCACCACCTGCAGCTGGACGG - Intergenic
935216650 2:100980247-100980269 CCGCCTCCACTGCAGGTGGAAGG + Intronic
935238455 2:101157505-101157527 CCGCATGTCCTGCCGTGGGATGG + Intronic
936337771 2:111605789-111605811 CCGCTTCTCCTGCTCCAGGAAGG + Intergenic
936339663 2:111619746-111619768 CCACATCTTGTGCTGCTGGAGGG - Intergenic
937536536 2:122895768-122895790 ACTCATGTCCTGCAACTGGATGG + Intergenic
938683002 2:133711378-133711400 TTGCTTCCCCTGCAGCTGGATGG - Intergenic
939911594 2:147989954-147989976 CCCCATCTGCTGGAGCTGTAAGG - Intronic
940032431 2:149278177-149278199 CCGCATCTCCTGGAGTTTGTGGG - Intergenic
942148810 2:173054468-173054490 CTGCATCTCCTGCCTCAGGAAGG - Intergenic
942225940 2:173816095-173816117 CAGCCTCCCATGCAGCTGGATGG - Intergenic
943212110 2:184980193-184980215 CCTCATCTCCTGCAGCTGCAGGG + Intergenic
945525449 2:210883306-210883328 CCGTATCTGCTACAGCTAGAGGG + Intergenic
946312849 2:218892494-218892516 CCGCCTTTCCAGCAGCTGCAGGG - Intronic
947586477 2:231360035-231360057 CCTCTTCTCCTACAGCTGAAGGG - Intronic
1171212573 20:23328069-23328091 CAGCATCACCTGCATCTGGAAGG + Intergenic
1172318379 20:33974830-33974852 CCACATCTCATGCCACTGGAAGG - Intergenic
1173910069 20:46661624-46661646 CCCCATTTCCTGCACCTGGGAGG + Intronic
1174170911 20:48617770-48617792 CCGCAGTTCTGGCAGCTGGAGGG + Intergenic
1174274040 20:49390646-49390668 CAGCCTCCCCTGCAGCTGGATGG + Intronic
1177095082 21:16822765-16822787 CCTAATCTCCTGTAGCTGGAAGG + Intergenic
1179540441 21:42080001-42080023 CTGCAACTCCTGCCGCTGGAGGG + Intronic
1180985753 22:19903164-19903186 CAGCCTCTCCTGCAGCTGCCAGG - Intronic
1181173580 22:21023585-21023607 GCTCTTCTCCTGCAGCTGGAAGG - Exonic
1181783096 22:25207194-25207216 CCGCTTCCCCAGCAGCTGAAAGG + Exonic
1183344325 22:37298805-37298827 CCCCAGCTCCTGAAGCAGGAAGG - Intronic
1183650995 22:39153074-39153096 CCGGCTCTCCTGCAACTCGAGGG - Intergenic
1183668681 22:39259503-39259525 TGGCATCTCCTCCTGCTGGATGG + Intergenic
1183774879 22:39957469-39957491 CGGCCTTTCCTGCAGCTGGCTGG + Intronic
1184405716 22:44299317-44299339 ACGTAACTCCTGCATCTGGATGG + Intronic
1184483151 22:44759844-44759866 CCTCACCTCTTGCAGCTGGAGGG + Intronic
950426922 3:12929349-12929371 CGGCATCGACTTCAGCTGGAAGG + Intronic
954301283 3:49702036-49702058 CCCCATCTCCTGGAGCCTGAGGG + Intronic
955547041 3:60042106-60042128 ACGCATCTCTTGCAGATGGCTGG + Intronic
959946076 3:112126601-112126623 CAGTATCTCCTGCAGCTGTCAGG + Intronic
960719330 3:120610432-120610454 CTGAATTTCCTGGAGCTGGATGG + Intergenic
961661736 3:128472608-128472630 CCGAGACTCCTGCAGCTGCAGGG + Intergenic
962533496 3:136305182-136305204 AAGCATCTCCTGAACCTGGAAGG - Intronic
962985244 3:140530614-140530636 CCACATCTGCTGAAGCTGGATGG - Intronic
963852660 3:150223941-150223963 CTTCATCTCCTGCAGCTGGAAGG + Intergenic
967547474 3:190748903-190748925 CCTCATCTCTTGCAGCTACAAGG - Intergenic
967947267 3:194813961-194813983 TTTCATCTCCTGCACCTGGAGGG + Intergenic
968577987 4:1376808-1376830 CCTCAGCTCCTGCCGCAGGACGG + Intronic
969325437 4:6441367-6441389 GCTCCTCCCCTGCAGCTGGAGGG - Intronic
969547791 4:7843190-7843212 CCGCTTCTTCCGCAGCAGGAAGG + Exonic
969698107 4:8747431-8747453 CCCCAACTCATGCAGGTGGAGGG - Intergenic
971402923 4:26293271-26293293 CCCCATCTCTTGCATCTGGAAGG + Intronic
972617980 4:40718679-40718701 TTGAATCTCCTGCACCTGGATGG + Intergenic
982682197 4:158444835-158444857 CAGCAACTCCTGCTGCTGGCAGG - Intronic
984680353 4:182601107-182601129 CCAGCTGTCCTGCAGCTGGACGG - Exonic
984864499 4:184270190-184270212 CCACATACCCTGCAGCTGAATGG + Intergenic
985041457 4:185895485-185895507 CTGCATCTGCTGCAGCAGAACGG - Intronic
985101115 4:186459575-186459597 CCCTATTTCTTGCAGCTGGAAGG + Intronic
985564191 5:607101-607123 CACCAGCTCCTGCAACTGGAAGG + Intergenic
985728265 5:1526855-1526877 CCTTCTCTGCTGCAGCTGGAAGG + Intergenic
988914702 5:35880850-35880872 GGGCATCTCCTGAACCTGGAAGG - Intergenic
989255583 5:39362916-39362938 CCCCAGCTCCAGCAGCTGCACGG - Intronic
989635714 5:43530810-43530832 CTGCAGCTGCTGCAGCTGGGAGG + Intronic
991256689 5:64622052-64622074 CCTCATCTTCTGTAGCTGGAGGG - Intergenic
995244481 5:109920913-109920935 ACGAACCTCCTGCAGCTGCAGGG - Intergenic
997336908 5:133115002-133115024 CCCCAGCCCCTGCAGCTTGAAGG + Intergenic
997827087 5:137116118-137116140 CCACATCTCCTGCAGGCTGATGG + Intronic
999535026 5:152506648-152506670 CCTCATCTCCTGCAGCTAGAGGG - Intergenic
1001043309 5:168352503-168352525 CCTTAGGTCCTGCAGCTGGAAGG - Intronic
1001073674 5:168607836-168607858 CCTCATCGCCTGCAGCTAGAGGG - Intergenic
1001086272 5:168701995-168702017 GCCCATCTTCAGCAGCTGGAAGG + Intronic
1001546201 5:172571806-172571828 CCGCATGCCTTGCAGCTGGGAGG + Intergenic
1003760898 6:9177627-9177649 CTTTATCTCCTGCAGCTGCAGGG - Intergenic
1004647334 6:17574845-17574867 CAGCCTCTCTTGCAGTTGGATGG + Intergenic
1006054850 6:31376735-31376757 CCTAATCTCCTGTAGCTGCAGGG - Intergenic
1006290049 6:33127994-33128016 CAGCATCTCCAGGATCTGGAAGG - Intergenic
1006522168 6:34577190-34577212 CAGCATTTCTTGCAGATGGAAGG + Intergenic
1012256319 6:97036798-97036820 TTGCATCCCCTGGAGCTGGAGGG - Intronic
1012887226 6:104859726-104859748 CCGCGTCTCCGCCTGCTGGACGG - Exonic
1013088395 6:106876067-106876089 CTGCATCTCCTGAGGCTGCACGG + Intergenic
1014787876 6:125638803-125638825 CCTAATCTCTTGCAGCTGGAGGG - Intergenic
1015259353 6:131217331-131217353 CGCCACCTGCTGCAGCTGGATGG + Intronic
1017722009 6:157249934-157249956 CCGCCTCTCCAGCAGCTGCCTGG + Intergenic
1019536680 7:1533124-1533146 CCTCATCTACAGCAGCTGGTCGG - Intronic
1020056549 7:5121474-5121496 CCGCATTCCCTGCAGCCGCAGGG + Intergenic
1020171353 7:5847499-5847521 CCGCATTCCCTGCAGCCGCAGGG - Intergenic
1021276487 7:18657974-18657996 GCGCAGCTCCTGGAGGTGGAAGG - Intronic
1021716563 7:23468098-23468120 TCGCCTCTCCTGCTCCTGGAGGG + Intronic
1022286895 7:28962116-28962138 CAGCAGCTCCTGGAGCTGGCAGG + Intergenic
1022785756 7:33635236-33635258 CAGCATCTCCAGCTGATGGAGGG + Intergenic
1027288142 7:76671906-76671928 CTTCATCTCCTGCAACTAGAGGG + Intergenic
1027329797 7:77079800-77079822 CCCCACCTCCTGAAGCAGGAAGG - Intergenic
1030110985 7:106026813-106026835 CTGCATCTTCTGTGGCTGGAAGG + Intronic
1033285870 7:140040161-140040183 CCGGCTCTCCTGGAGATGGAGGG - Intronic
1033659768 7:143395333-143395355 CCGCATATTCTGCATCTGGAAGG - Exonic
1033759310 7:144422731-144422753 CCCCTCCTCCTGCAGCTTGAAGG + Intergenic
1034270649 7:149802106-149802128 CAGCAGCTCCTGGCGCTGGAAGG - Intergenic
1034685312 7:152966037-152966059 CTTCTTTTCCTGCAGCTGGATGG + Intergenic
1035601412 8:899146-899168 CCGCATCTCCAGCCCCTGGATGG + Intergenic
1036738792 8:11343152-11343174 CCTCTACTCCTGCAACTGGAAGG + Intergenic
1037232767 8:16679369-16679391 CTGCCTCTGGTGCAGCTGGATGG - Intergenic
1037459582 8:19095450-19095472 CAGCAGCTCCTGCAGATGGGTGG + Intergenic
1039273258 8:35906571-35906593 CCCCCACTCCTGCAGCTGTATGG + Intergenic
1039479278 8:37859790-37859812 CAGCATCTGCAGCAGCTGGAAGG + Exonic
1040534075 8:48290625-48290647 TACAATCTCCTGCAGCTGGAAGG - Intergenic
1040574905 8:48643543-48643565 CTGCATGTCCTGCACTTGGAAGG + Intergenic
1042508920 8:69591046-69591068 CCCCTTCTCCTCCAGCTTGAGGG - Intronic
1048707097 8:137165983-137166005 TCTCATCTCCTGCAGCTGTATGG + Intergenic
1048932478 8:139326091-139326113 TCTCATCTTCTGCAGCAGGAGGG + Intergenic
1049154768 8:141059772-141059794 CCGCAGCCCCTGAAGCCGGAGGG + Intergenic
1049162311 8:141105235-141105257 CCTCATCTCCTGCAGCCCCAGGG + Intergenic
1049347980 8:142148885-142148907 ACCCCTCTCCTGCAGCTGTACGG - Intergenic
1049665701 8:143841532-143841554 CGGGGTCTTCTGCAGCTGGAGGG - Intergenic
1049706993 8:144047623-144047645 CCTCAGCTCCTGCAGCAGGTGGG - Intergenic
1050703148 9:8364436-8364458 TAGCATCTGCTGCAGCTGGCTGG + Intronic
1051022900 9:12567155-12567177 ACTCATCTCCTGTAGCTGAAGGG - Intergenic
1055401525 9:75929559-75929581 CCTCCCCTACTGCAGCTGGAGGG - Intronic
1056808537 9:89746510-89746532 GCGCCTCTCCTGCTGCTGGAGGG + Intergenic
1057524160 9:95784465-95784487 CCGCCTCTCCCGCGGCCGGAGGG + Intergenic
1059466312 9:114470837-114470859 CTTCATGTCCTGGAGCTGGAAGG - Intronic
1060883395 9:127134081-127134103 CGGCGCCTGCTGCAGCTGGATGG - Intronic
1061047787 9:128176467-128176489 CTGGAACTCCTGCAGCAGGAGGG + Exonic
1061408954 9:130407987-130408009 CAGCACTACCTGCAGCTGGATGG + Intronic
1061877740 9:133553358-133553380 CCTCGTGTCCTGCAGCTGGAAGG - Intronic
1061972657 9:134053349-134053371 CTGCATGTACTGCAGCTGGTTGG + Exonic
1062374458 9:136255684-136255706 CGGCATCTCCTCCACCTGGCTGG - Intergenic
1062491909 9:136808719-136808741 CCGCACCTCCTGCAGGTGAGTGG - Intronic
1062730359 9:138105071-138105093 AGGCAGCTCCTGCTGCTGGAAGG - Intronic
1188482897 X:30653116-30653138 CCCCATGCCATGCAGCTGGATGG + Intergenic
1189665963 X:43355081-43355103 CCTGATCTCCTGTAGCTGCAGGG - Intergenic
1190113455 X:47610122-47610144 CCTCATCTCCTGCAGTCAGAGGG + Intronic
1190115820 X:47625913-47625935 CCCCACTTCCTGCAGCTGGGAGG + Intronic
1190634043 X:52417312-52417334 CCCCCTCTCTTGCAGTTGGAGGG - Intergenic
1190650699 X:52565824-52565846 CCAGTTCTCTTGCAGCTGGAGGG + Intergenic
1191782851 X:64886910-64886932 CAGCATCTCCTGCAGCTGAGGGG - Intergenic
1192198413 X:69047862-69047884 CCACCTCTCCTGCAGCTGGTGGG - Intergenic
1199198177 X:145057015-145057037 TCTCATCTCCTGCAGCTGAAGGG + Intergenic
1202095972 Y:21248536-21248558 CTGCAGCTGCTGCAGCTGTAGGG + Intergenic