ID: 1081550373

View in Genome Browser
Species Human (GRCh38)
Location 11:44106207-44106229
Sequence AGAAGTACCATGCAAATTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 243}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081550369_1081550373 21 Left 1081550369 11:44106163-44106185 CCTAGATTCATGGGGAAGGGACA 0: 1
1: 4
2: 21
3: 107
4: 477
Right 1081550373 11:44106207-44106229 AGAAGTACCATGCAAATTCAGGG 0: 1
1: 0
2: 1
3: 15
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081550373 Original CRISPR AGAAGTACCATGCAAATTCA GGG Intronic
901721725 1:11203964-11203986 AGAAGGCCCAAGCAAACTCATGG + Intronic
901964299 1:12853540-12853562 AGAGGTCACATGCAAATTCAAGG - Intronic
901970639 1:12905072-12905094 AGAGGTCACATGCAAATTCAAGG - Intronic
901991815 1:13121316-13121338 AGAGGTCACATGCAAATTCAAGG - Intergenic
902014526 1:13296698-13296720 AGAGGTCACATGCAAATTCAAGG + Intergenic
902028814 1:13405814-13405836 TGAGGTCACATGCAAATTCAAGG + Intergenic
902407839 1:16195778-16195800 AGAAGCAGAATTCAAATTCAAGG + Intergenic
905660688 1:39721651-39721673 AGAAGTATCTTGCATGTTCATGG - Intronic
907691882 1:56676967-56676989 AGTACTGCCATGCAATTTCAGGG - Intronic
907827563 1:58033378-58033400 ATAAGCACCATACAACTTCACGG + Intronic
907827696 1:58034902-58034924 AGAAGCAGCATGCACATACATGG - Intronic
908623973 1:66019288-66019310 AAATGTCCCATGCAAATTGATGG + Intronic
908680024 1:66650260-66650282 AGAAGTACCATATGTATTCAGGG - Intronic
909069058 1:70971667-70971689 GGAAGAAATATGCAAATTCAGGG + Intronic
909276694 1:73695877-73695899 AGAAGTACCTAGCAATTTAAAGG + Intergenic
909446242 1:75751880-75751902 AGAATTACCCTGGAAATTCATGG - Intronic
909604810 1:77497525-77497547 AGAAGTGCCATGCAAAGAGAAGG + Intronic
910000129 1:82331316-82331338 ACAAGTCCCAGGCAAATCCATGG - Intergenic
911855281 1:102868818-102868840 AGCTGTACCCTGCAAAGTCAGGG - Intergenic
911947180 1:104126612-104126634 AGTAGTATCAAGCAAATACATGG + Intergenic
912126450 1:106544748-106544770 ATAAGTAGCATCAAAATTCAAGG - Intergenic
912616913 1:111111025-111111047 AGAAATAACATGCAAAAACATGG - Intergenic
912621332 1:111162145-111162167 AAAAGTTCCCTGCAGATTCAGGG - Intronic
916664126 1:166950121-166950143 AGAAGTAGCCTCCAAATTTATGG + Intronic
916944405 1:169711495-169711517 AGAAGGACCAAGCAAAGCCATGG - Exonic
920780521 1:208986708-208986730 AGAGGAACCCTGCAAAATCATGG - Intergenic
921087144 1:211805486-211805508 AGTAGAACCATGAAAAGTCAGGG + Intronic
921906439 1:220500328-220500350 ACAAGTTCCATGCACACTCAAGG - Intergenic
922471665 1:225880926-225880948 AGAAGGCCCGTACAAATTCAGGG + Intronic
923062533 1:230488988-230489010 ACAAGTAGAATTCAAATTCATGG - Intergenic
923976868 1:239273834-239273856 AGAAGAACCATACAACATCATGG - Intergenic
924045969 1:240030986-240031008 ATAAATACCATGAAAATACAGGG + Intronic
924090296 1:240494045-240494067 AGAAGTACAAAGCAAATGCTGGG + Intronic
1063521397 10:6744698-6744720 AGAAATCCCATGCAATTCCAAGG + Intergenic
1063892545 10:10645229-10645251 AGAAGCACCATTCACTTTCAGGG + Intergenic
1064523553 10:16229337-16229359 AGAAGTAGCATGGAGATTCCTGG - Intergenic
1064910107 10:20391740-20391762 AGGAGTTCCATGTAAATTCTAGG - Intergenic
1065783854 10:29194770-29194792 TAAACTACCATGCAAATGCATGG - Intergenic
1069479210 10:68765754-68765776 ATAAGTACCATGAAGAGTCATGG + Intronic
1070258268 10:74828325-74828347 GGAGGTACCAAGGAAATTCAGGG + Intronic
1077892309 11:6428141-6428163 AAAGGTACCATGGAAAATCAAGG + Intergenic
1077933362 11:6756639-6756661 ATAAGTAGCATGGAAATGCAAGG + Intergenic
1078985181 11:16587203-16587225 AGAAATACCATAGAACTTCAAGG + Intronic
1079716594 11:23755834-23755856 AGAAGTGCCAAGCAAAGTGAGGG - Intergenic
1080163731 11:29211603-29211625 AAAAGCCACATGCAAATTCAAGG - Intergenic
1080348062 11:31347811-31347833 AGAGGTACCTTGCCAATTAATGG + Intronic
1081550373 11:44106207-44106229 AGAAGTACCATGCAAATTCAGGG + Intronic
1081747112 11:45481105-45481127 TTAAGTACCATGGGAATTCAAGG - Intergenic
1083298150 11:61726354-61726376 AGAAGAAATATGCAAAGTCAGGG + Intronic
1084464603 11:69314834-69314856 AGAAGTATGATGCAAAGGCAGGG - Intronic
1085830558 11:79896018-79896040 AGGAGTACTGTACAAATTCAAGG + Intergenic
1087540140 11:99506148-99506170 AGCCGTACCATTCAGATTCATGG - Intronic
1090906351 11:131077737-131077759 AGAAGCACTATGCAAATGGAAGG - Intergenic
1091047702 11:132338920-132338942 GGATGTACCAAGCATATTCATGG + Intergenic
1092551611 12:9508304-9508326 TTACGTACCATGCAAAATCAAGG - Intergenic
1092980235 12:13787393-13787415 AAAAGTACTATTCAAATTCTAGG + Intronic
1093363791 12:18266956-18266978 AGATGTAATATGCATATTCAGGG + Intronic
1098299157 12:69036499-69036521 TCAAGGACCAAGCAAATTCAAGG - Intergenic
1098718921 12:73869721-73869743 AGAAGGATAATGTAAATTCAAGG + Intergenic
1098827933 12:75322291-75322313 AGAAGTGCTATACAAATACAAGG + Intronic
1098960652 12:76736670-76736692 AAAAAAACCATGCAAATACATGG - Intergenic
1100201790 12:92306562-92306584 AGGAGTAGCATGCACATACAAGG + Intergenic
1100446965 12:94669811-94669833 AGAAGTACTTTGCACAGTCATGG - Intergenic
1106779179 13:33039740-33039762 AAAAGTAGAATGCAACTTCAGGG + Intronic
1107027625 13:35819140-35819162 ACAAGAACCATGTAAAATCATGG + Intronic
1109819279 13:67631766-67631788 AGAAGTAGACTGGAAATTCAAGG + Intergenic
1109898408 13:68727450-68727472 AGCAGTACTATGTGAATTCAAGG + Intergenic
1110709774 13:78637581-78637603 AGAAGAACCAGGGAAATTAAAGG + Intronic
1111229389 13:85322761-85322783 AGAATTACCATTCAAAATCAAGG + Intergenic
1111516028 13:89332697-89332719 ATAAATACCATGAAACTTCATGG - Intergenic
1112669171 13:101614836-101614858 AGAAGCACTATGCAAATGAAGGG - Intronic
1113020683 13:105883359-105883381 ACAATTAATATGCAAATTCAAGG + Intergenic
1117246674 14:53893504-53893526 GAAAGTACTATGCAAATTGAAGG - Intergenic
1123976247 15:25557063-25557085 AAAAGAACCAAGCAAATGCAGGG - Intergenic
1124213965 15:27791139-27791161 ACAAGTTCCATGCAATTTGATGG - Intronic
1125335664 15:38623819-38623841 TGAAGTACCATGCATATGCAAGG - Intergenic
1126422119 15:48485737-48485759 AGAAGGACCATGCAAAATCCTGG + Intronic
1127025628 15:54802534-54802556 AGGAGGACCATCCATATTCAAGG + Intergenic
1131357864 15:91761532-91761554 AGAGGAACAATTCAAATTCAGGG - Intergenic
1134383935 16:13754335-13754357 AGCAATACCATGCAAAATAAAGG - Intergenic
1134646856 16:15875583-15875605 AGAGGCAACTTGCAAATTCATGG + Intronic
1137936646 16:52641102-52641124 ATAAGTGCCATGCCATTTCATGG - Intergenic
1138852717 16:60649429-60649451 TGAAATGCCATGCAAATTAAAGG - Intergenic
1139758622 16:69166133-69166155 AGAAAAGCCATACAAATTCAGGG - Intronic
1140338981 16:74138919-74138941 AGAAGTTACATACAAATGCAAGG + Intergenic
1140748271 16:78000042-78000064 ACAGGTTCCATGCAAACTCAAGG + Intergenic
1143815749 17:9512920-9512942 AAAAGTACCAGGCAAAAACAAGG + Intronic
1144057649 17:11556938-11556960 GCAAGTTCCAGGCAAATTCAAGG + Intronic
1144467964 17:15511907-15511929 AGAAGTGCCAGGAAGATTCAAGG + Intronic
1145305676 17:21673831-21673853 AGCAGAACCCTGAAAATTCAGGG - Intergenic
1146495691 17:33319978-33320000 AGAACAACCAAGCAAACTCAGGG + Intronic
1146562991 17:33887858-33887880 AGTAGAACCATGGCAATTCAAGG - Intronic
1146675558 17:34771535-34771557 ACAACTACCATGTAAATTGAAGG - Intergenic
1149113762 17:53066021-53066043 AGAAGTATAATGCAAATACCTGG + Intergenic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1203167539 17_GL000205v2_random:111740-111762 TCAAGTCACATGCAAATTCAGGG + Intergenic
1153192865 18:2561866-2561888 AGAAATACCAGGAAAATCCAGGG - Intronic
1154206614 18:12342787-12342809 AGAGGTACCAGGATAATTCAAGG - Intronic
1154392264 18:13948452-13948474 AAAAGTACTGTGCAAATTCTAGG - Intergenic
1154944028 18:21143159-21143181 AGATGTACCATGTATATTCGTGG - Intergenic
1159632371 18:70763757-70763779 ACAATCAACATGCAAATTCACGG - Intergenic
1159637448 18:70822458-70822480 AGGAGGACCATACAAATTAAAGG + Intergenic
1160036672 18:75308195-75308217 AAAAGTGTCATGCACATTCAAGG + Intergenic
1168299486 19:55395870-55395892 AGAAATTCTATGCAAATGCAAGG + Intronic
925574241 2:5344121-5344143 AGAAGTTCCGTGCTAAGTCAGGG + Intergenic
925634426 2:5928922-5928944 AGAAGGACCATGGAAGTCCAGGG - Intergenic
925691768 2:6531850-6531872 AGATGTACCATCCAAATACTAGG - Intergenic
927621854 2:24669417-24669439 AGAAGTGACATGCAATTTCTGGG - Intronic
927816199 2:26219682-26219704 AGCAGCACCATGCCAAATCAAGG + Intronic
928108997 2:28491264-28491286 AGAAGTAACATGGGGATTCATGG - Intronic
928470892 2:31574399-31574421 AGAATTACGATGGGAATTCAAGG - Intronic
928623842 2:33119070-33119092 ATAAGAAACAAGCAAATTCAAGG + Intronic
932248547 2:70219439-70219461 TGAAGGAACAGGCAAATTCAAGG + Intronic
935504705 2:103885740-103885762 TAAAGTACCATACAAACTCAAGG + Intergenic
936051770 2:109229320-109229342 AAAAGTACCATGCTAATGTAAGG - Intronic
937038459 2:118802097-118802119 AGAAGAACAATACAAATGCAAGG - Intergenic
939610608 2:144305587-144305609 AAAAGTTACATGGAAATTCAGGG - Intronic
939819613 2:146940524-146940546 AGAAATTCCATGCAACTGCAAGG + Intergenic
941230867 2:162911070-162911092 AGAAGAACCATGAAAATAGATGG - Intergenic
943473356 2:188323223-188323245 GGAAGTACAATGGCAATTCAGGG - Intronic
944243020 2:197504043-197504065 ACAAGTACCATGTAAATTGAGGG + Intronic
944912893 2:204327603-204327625 AGAAGTACAAAGCAAATTTGGGG + Intergenic
945507393 2:210658189-210658211 TGCAGTACCATGTAATTTCAGGG + Intronic
946036179 2:216744170-216744192 AGAAGTAACATGGCAAGTCAGGG - Intergenic
946715967 2:222555758-222555780 AGAAGAACCAGGCTATTTCAGGG + Intronic
946994883 2:225379993-225380015 AGAAATACCATGCAGTTGCATGG - Intergenic
947199391 2:227600890-227600912 AGAAGTGTCATGCTCATTCAAGG + Intergenic
1169552540 20:6715684-6715706 AGAAATACCATGAAAATCCTGGG + Intergenic
1169813573 20:9633254-9633276 GTGAGTCCCATGCAAATTCAAGG + Intronic
1171523189 20:25791319-25791341 AGCAGAACCCTGAAAATTCAGGG - Intronic
1171530932 20:25853299-25853321 AGCAGAACCCTGAAAATTCAGGG - Intronic
1171553637 20:26064564-26064586 AGCAGAACCCTGAAAATTCAGGG + Intergenic
1172262124 20:33576426-33576448 AAAAGCACCATGCAAATATAAGG - Intronic
1174672098 20:52318144-52318166 AGAAGGGCCATGCAAATACCTGG + Intergenic
1176404219 21:6347395-6347417 TCAAGTCACATGCAAATTCAGGG - Intergenic
1176432938 21:6641709-6641731 TCAAGTCACATGCAAATTCAGGG + Intergenic
1176989993 21:15484029-15484051 ACAAGTACCAGGAAAATTGAAGG + Intergenic
1177470145 21:21549806-21549828 TGAAGTACAATGCAAATCAAAGG - Intergenic
1178601238 21:33996348-33996370 AGGAATACCATGCAGAATCATGG - Intergenic
1184982985 22:48107337-48107359 AGAAGATCCAGGCAAATTCTGGG + Intergenic
949663693 3:6311802-6311824 AGCAGTACCTAGCAATTTCATGG - Intergenic
951102845 3:18709432-18709454 AGAAGTACCATGAAAAACGATGG + Intergenic
951975668 3:28505038-28505060 AGGAGTACCAGGAAACTTCAAGG - Intronic
952089893 3:29872598-29872620 AGAAGGACCATGCAACTTGTTGG + Intronic
952196935 3:31085588-31085610 AGAAGTTCCATGCATAGCCAGGG + Intergenic
953927704 3:46990742-46990764 AGAAGTCCCAGGCAAAGGCATGG + Intronic
955588660 3:60510448-60510470 AGATGCTCCATTCAAATTCAAGG - Intronic
956995425 3:74821922-74821944 TTAAGAACCATGCAAATACATGG - Intergenic
957175649 3:76804601-76804623 AGAAATAGCATTCAAATTTAGGG - Intronic
958094786 3:88929716-88929738 AAAAGTCCCATGAAAACTCAGGG - Intergenic
958164078 3:89856663-89856685 AGCAGGACCTTTCAAATTCATGG - Intergenic
958262571 3:91399065-91399087 AGAAATACATTGCAAATTGATGG + Intergenic
959100291 3:102002176-102002198 AGAAATACCAGGAAAATACAAGG + Intergenic
959606162 3:108244039-108244061 AGAAGTGCCAAGCAAAAGCAGGG - Intergenic
959847142 3:111046351-111046373 AGAAGTACCATTCCCATTCCTGG + Intergenic
960717045 3:120586185-120586207 ATAAGTAGGATGCAAATTTAGGG + Intergenic
962584914 3:136832494-136832516 ACAAGTACTATGCACATTAAAGG - Intronic
963612458 3:147487477-147487499 AGAAGTAACATGCCACTTCCAGG - Intronic
963933124 3:151024848-151024870 AGGAGAAGCATGCACATTCAGGG + Intergenic
964643263 3:158932000-158932022 AGAAGGTCCATGATAATTCAGGG - Intergenic
971185143 4:24368288-24368310 TGAAGTACCATACAATTTTAGGG + Intergenic
971602857 4:28617883-28617905 ATAAATCACATGCAAATTCATGG - Intergenic
971903739 4:32698179-32698201 AGAAGTAACATGTAACTTCTAGG + Intergenic
972487330 4:39554806-39554828 AGAGGTAACTGGCAAATTCATGG + Intronic
972668365 4:41189990-41190012 AGAAGTCCCTTAAAAATTCATGG + Intronic
974156204 4:58076413-58076435 AGAAGAAGCAAGCAAATCCAAGG + Intergenic
974232003 4:59128414-59128436 ATACGTAGCATGCAATTTCAAGG + Intergenic
974329056 4:60452947-60452969 AAAAGTTCCAGTCAAATTCAAGG - Intergenic
974836424 4:67256681-67256703 AGTAGTTCAATGCAAATTTAGGG + Intergenic
975248318 4:72146678-72146700 AGACGGTCCATGCAAATTAATGG + Intronic
977071646 4:92397629-92397651 AGAAGTGGCATGAAAATACATGG + Intronic
977802075 4:101246882-101246904 AGGAGAAGCCTGCAAATTCAAGG - Intronic
978462627 4:108973897-108973919 ATAAGTATCATGCAAACTTATGG + Intronic
979419912 4:120490874-120490896 AATATTACCATGCAGATTCATGG - Intergenic
979777362 4:124607252-124607274 ATAATTACAAGGCAAATTCAAGG - Intergenic
980636280 4:135508278-135508300 AGAGTTACCATACAAAATCATGG - Intergenic
980784858 4:137539303-137539325 GTAAATACCATGCAACTTCATGG + Intergenic
981740384 4:147995695-147995717 AGATGGACCATGCAAATTTTTGG - Intronic
982635134 4:157886504-157886526 AGAATTACCATGGAAATTCCTGG + Intergenic
984542677 4:181060215-181060237 AGAAGTAGCAAGCAACTTGAAGG + Intergenic
984628220 4:182032793-182032815 AGAAGAAACAGACAAATTCATGG - Intergenic
985243303 4:187953879-187953901 AAAAGTACAATGAAAAATCATGG - Intergenic
985424971 4:189821082-189821104 AGAAATATCATGGAACTTCAGGG - Intergenic
986227574 5:5829838-5829860 AGAATTGCTATGCAAAGTCAAGG + Intergenic
987080334 5:14419982-14420004 AGAAGTAGCATGGAAATGGAGGG + Exonic
987936452 5:24471663-24471685 ATAAGTACAATTCAAATACAGGG - Intergenic
988237009 5:28558784-28558806 AGCAGGAACATGAAAATTCAAGG + Intergenic
989409713 5:41104847-41104869 AGAAGTTCCAAGCAGATTAAAGG - Intergenic
991898073 5:71426759-71426781 AGATGTATCAGGCAAATTCTTGG + Intergenic
993482103 5:88436468-88436490 AGAGATGCCATGCCAATTCAAGG + Intergenic
995150154 5:108834026-108834048 AAAAGTATCATTCAAATGCAAGG - Intronic
995155158 5:108902261-108902283 AGAAGTACAATGATAATTTATGG + Intronic
997721128 5:136079233-136079255 AGAAGGACCTTGGAGATTCACGG - Intergenic
999435974 5:151563589-151563611 AGTAGTAAGATGCAAATTCTCGG + Exonic
999578032 5:153002412-153002434 AGAAGAACCACGAAAATTCTAGG - Intergenic
1000780000 5:165468191-165468213 AGGAAAACCATGCAAATACATGG + Intergenic
1001350499 5:170958448-170958470 AGCAGGGCCAAGCAAATTCAAGG + Intronic
1005000469 6:21235107-21235129 TCAAGTACCATGCACATTCTTGG - Intergenic
1005875811 6:30008792-30008814 GGAAGCACCATCCACATTCATGG + Intergenic
1008873145 6:56296681-56296703 AGAAGAAATATACAAATTCAGGG + Intronic
1008992844 6:57623812-57623834 AGAAATACATTGCAAATTGATGG - Intronic
1009181464 6:60522930-60522952 AGAAATACATTGCAAATTGATGG - Intergenic
1009743532 6:67781570-67781592 AGAGGTACAAAGCATATTCATGG + Intergenic
1010524261 6:76880985-76881007 AGAAGTACCATGCTAAGTTTTGG - Intergenic
1012943842 6:105445411-105445433 TAAAGTACCATTCAAATACAAGG + Intergenic
1013546328 6:111161335-111161357 ACAAGTCCCAGGCAAATCCATGG - Intronic
1014977921 6:127912048-127912070 GGAAGTACCCTGCAAAGTCATGG + Intronic
1015017113 6:128426897-128426919 AGGAGTACCAGGAAAAGTCAAGG - Intronic
1016804071 6:148195490-148195512 GCAGCTACCATGCAAATTCAAGG + Intergenic
1017548629 6:155480046-155480068 AGAAGTGCCATTCAGGTTCAGGG + Intergenic
1019085441 6:169471278-169471300 TGAACAACCATGCAAACTCATGG - Intronic
1021001230 7:15332694-15332716 ATAAGTACCAGGTACATTCATGG - Intronic
1021359082 7:19689465-19689487 AGAATTGCTATGAAAATTCAAGG - Intergenic
1022860847 7:34365035-34365057 AAAAGGAACATGCAAAGTCATGG + Intergenic
1025283628 7:57646228-57646250 AGCAGAACCCTGAAAATTCAGGG - Intergenic
1026400698 7:70009992-70010014 ATAAGTACTATTCAAATACAAGG + Intronic
1029997704 7:105024592-105024614 AGTACTAAAATGCAAATTCAAGG - Intronic
1030651750 7:112123424-112123446 AAAAGTAACATGAAAATTCATGG + Intronic
1030767168 7:113424716-113424738 AGAAGTCTCCTTCAAATTCAAGG + Intergenic
1030996375 7:116363530-116363552 AGAAGTACCATTACATTTCATGG - Intronic
1031264212 7:119564157-119564179 AGAAGTACCATTCTCTTTCATGG + Intergenic
1032514073 7:132494146-132494168 AGAGGTATCATGAAAATTAAAGG + Intronic
1036540855 8:9708598-9708620 AAAATTAACATGCAAATTCCTGG - Intronic
1037178504 8:15974895-15974917 AGAAGTGCCAAGCAAAGTGAGGG - Intergenic
1038127732 8:24693150-24693172 AGAAGTACTTTGCTAAGTCAAGG - Intergenic
1039160188 8:34610063-34610085 AAAAATACCAAGGAAATTCAGGG + Intergenic
1039296198 8:36157954-36157976 TGATTTACCATGCAAAATCATGG - Intergenic
1041279004 8:56192453-56192475 AGAAGTAACATACAAGTACATGG + Intronic
1047071139 8:121344747-121344769 TGAAGCACCCAGCAAATTCATGG - Intergenic
1047521968 8:125601865-125601887 TGAAGTACCATTCACATGCAGGG - Intergenic
1047641058 8:126822050-126822072 AAAAGTAGCATGGAAACTCATGG + Intergenic
1047802207 8:128321743-128321765 AGAATTAACATGCACATTCAAGG + Intergenic
1050224157 9:3432161-3432183 AGAAGTACCTTGTAAATAAACGG + Intronic
1050338828 9:4615634-4615656 AGAAGTACAATCCAAATGCAGGG - Intronic
1051038089 9:12773925-12773947 AGAAATAGCATGCAAATTTCTGG + Intergenic
1053615620 9:39762480-39762502 AGAAGTATTATGAAAAGTCAGGG + Intergenic
1053873790 9:42521743-42521765 AGAAGTATTATGAAAAGTCAGGG + Intergenic
1054237901 9:62579911-62579933 AGAAGTATTATGAAAAGTCAGGG - Intergenic
1054268542 9:62945013-62945035 AGAAGTATTATGAAAAGTCAGGG - Intergenic
1054552031 9:66614421-66614443 AGAAGTATTATGAAAAGTCAGGG - Intergenic
1055248836 9:74278194-74278216 GGAAGTAAAATACAAATTCAAGG - Intergenic
1203438597 Un_GL000195v1:166961-166983 TCAAGTCACATGCAAATTCAGGG - Intergenic
1185575003 X:1164236-1164258 ATAACTATCATTCAAATTCAGGG + Intergenic
1185907770 X:3952328-3952350 AGAAAGACAATGCAGATTCATGG + Intergenic
1186048163 X:5559070-5559092 AGAAGAAACATGCATATTTATGG + Intergenic
1186339554 X:8629481-8629503 AAAAGTACTTTGCAAATCCATGG + Intronic
1186991899 X:15078836-15078858 AAAAATACCATTCAAATTCAGGG - Intergenic
1187371737 X:18714736-18714758 AAAAGCACTATGCAAATACAAGG - Intronic
1187567753 X:20469023-20469045 AGAAGTTGCATGCTAATTCTTGG - Intergenic
1187610021 X:20932648-20932670 TAAAGGACCATACAAATTCATGG + Intergenic
1188290020 X:28376185-28376207 AGAAGTAGTATGCAAATAGATGG - Intergenic
1189924855 X:45941977-45941999 AAAAGTGCCAAGGAAATTCAAGG - Intergenic
1195089073 X:101441308-101441330 AGAATTTCCATGCAAATCCCAGG + Intronic
1198244653 X:134818450-134818472 AGTAGTACCATGAAAAAACAAGG + Intronic
1198890878 X:141395107-141395129 AGAAGTACCATATAATCTCAAGG + Intergenic
1199746750 X:150776469-150776491 AGAAGTCCTAGGCAAATCCAAGG - Intronic
1199884447 X:152005625-152005647 AGAAGAACTATACAAATACATGG + Intergenic
1200279027 X:154761383-154761405 AGAAGCCCCTTGAAAATTCAGGG - Intergenic
1201961204 Y:19682359-19682381 AGAAGTGCCATGCAAATTCCAGG + Intergenic
1202605442 Y:26635771-26635793 AGGAGTTCCATGCACAGTCAAGG - Intergenic