ID: 1081551365

View in Genome Browser
Species Human (GRCh38)
Location 11:44115644-44115666
Sequence TCTCATGGAAATAGTTTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081551360_1081551365 29 Left 1081551360 11:44115592-44115614 CCAATAGATAAATTTTGACACTA 0: 1
1: 0
2: 0
3: 13
4: 189
Right 1081551365 11:44115644-44115666 TCTCATGGAAATAGTTTGCCTGG 0: 1
1: 0
2: 2
3: 10
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081551365 Original CRISPR TCTCATGGAAATAGTTTGCC TGG Intronic
903109468 1:21117999-21118021 TCTCAGTGAACTAGTTTGCAGGG - Intronic
906508196 1:46395367-46395389 GCTCATGGAAAGGGCTTGCCAGG - Intronic
909538413 1:76764529-76764551 ACTTATGGAAATAGATTCCCCGG - Intergenic
909574959 1:77164257-77164279 TCTCATCAAAAATGTTTGCCTGG - Intronic
909992673 1:82241859-82241881 TCACATGGAATTATTGTGCCAGG - Intergenic
910359797 1:86404315-86404337 TCTCTTGGAAATACTTCCCCAGG + Intergenic
913200876 1:116494520-116494542 ACTCATTGAAATAGTTTCTCTGG - Intergenic
915215553 1:154338247-154338269 GCCTATGGAAATAGTTGGCCAGG + Intronic
918516903 1:185373417-185373439 TCTTATTGAAATATTTTCCCAGG - Intergenic
919665345 1:200286042-200286064 TCTCATAGAAATTGTGGGCCGGG + Intergenic
920593495 1:207245453-207245475 TCTCAGGGAAATATTTTGCTAGG + Intergenic
920631105 1:207652907-207652929 TTTCTTGGCAATAGATTGCCTGG + Intronic
920641631 1:207757369-207757391 TTTCCTGGCAATAGATTGCCTGG + Intronic
922309396 1:224373936-224373958 ACTCATGTAACTGGTTTGCCTGG + Intronic
1068513862 10:58001915-58001937 TTTCAAGGAAATACTTTGTCAGG - Intergenic
1073560187 10:104489660-104489682 CCTCATGTACATGGTTTGCCTGG - Intergenic
1074106102 10:110390821-110390843 TCTCATTTAAATAGTTTACAGGG + Intergenic
1076118765 10:127919736-127919758 TCTCCTGGAAGTAATTTGCCAGG - Intronic
1077985512 11:7347529-7347551 TTTGATGGAAATAGTTCGGCTGG - Intronic
1078376478 11:10798162-10798184 TCTCATGCTACTAGTTTTCCAGG - Intronic
1079399144 11:20091742-20091764 TCTCATGGAAAGAGTGTTTCAGG - Intronic
1081551365 11:44115644-44115666 TCTCATGGAAATAGTTTGCCTGG + Intronic
1082044148 11:47711359-47711381 TCTTATGCAAATAGTTGCCCAGG - Intronic
1084399671 11:68936421-68936443 TCTCATGGGAATAGTTTTCTGGG - Exonic
1085603546 11:77877121-77877143 CCTCGTGGAAATAGACTGCCTGG + Intronic
1089384128 11:118056962-118056984 TCTCATGGAAATGTGTGGCCTGG - Intergenic
1095848481 12:46773940-46773962 TCTCAGTGAAGTTGTTTGCCTGG + Intronic
1100358984 12:93858893-93858915 TCTAATGGAAATAGACTGCGTGG - Intronic
1103575621 12:121875088-121875110 TTTTATGGAAAATGTTTGCCAGG - Intergenic
1105374306 13:19829584-19829606 TCTCAAAAAAATTGTTTGCCAGG - Intronic
1108779333 13:53809618-53809640 TCTTATGGCAATGGTTTGCCTGG + Intergenic
1109448787 13:62481521-62481543 TCTTATGAAAATTGTTGGCCAGG - Intergenic
1111058996 13:82987763-82987785 TTTCATGGCAATGGTTTGCCTGG + Intergenic
1111895704 13:94139014-94139036 TCTCCTGGAAACTGTCTGCCTGG - Intronic
1112556115 13:100470043-100470065 TCTCCTGGAAATACTTCCCCAGG - Intronic
1112883597 13:104140216-104140238 TCAAATGGACATAGTATGCCGGG - Intergenic
1113935804 13:113995133-113995155 TCTCATGGAGATAAATGGCCTGG + Intronic
1114578324 14:23733355-23733377 TCTGGTGGAAAAAGTTTGCAAGG + Intergenic
1115281901 14:31672823-31672845 TCTATTGGAAATAGTATGCTTGG + Intronic
1116007218 14:39307212-39307234 TCACCTGGAAATAGTTTTACGGG + Intronic
1118042047 14:61927909-61927931 TCTCAAGGAAATATCATGCCTGG + Intergenic
1127175296 15:56348288-56348310 TCTCCTGGAAGTAGTTTGTTAGG + Intronic
1127731860 15:61809100-61809122 TTTCATTGAAATAGTTTTCCTGG + Intergenic
1130880073 15:88047279-88047301 ACTCATGGAAATATTTTATCTGG - Intronic
1143343395 17:6231884-6231906 TCTCAAGGAAATCCTTTGCTGGG + Intergenic
1153318365 18:3747258-3747280 AAACATGAAAATAGTTTGCCAGG + Intronic
1159765242 18:72480989-72481011 TCTCATGGAGAATGTCTGCCAGG + Intergenic
1161587638 19:5114171-5114193 TCGCGTGGAAAGAGTTTGCATGG - Intronic
1164150473 19:22546057-22546079 TCTCAGGGAACCAGTTTTCCAGG - Intergenic
1164184930 19:22857312-22857334 TCACATTGAAATATTTTGCTCGG - Intergenic
1167496883 19:49824762-49824784 CCTCATGGAACTAGTTTGCCTGG + Intronic
925552428 2:5090818-5090840 GCTCAGGGAAATAGCTCGCCTGG - Intergenic
926502443 2:13673139-13673161 TCTCATGGAAAACATCTGCCAGG - Intergenic
926824953 2:16896849-16896871 TCTCATGGATATAGTACTCCAGG + Intergenic
928096018 2:28405435-28405457 TGTCACTGAAATAGTTTCCCAGG - Intronic
929389364 2:41451435-41451457 TCTCATGGCAATAGTTTTGAAGG + Intergenic
929504764 2:42519879-42519901 TCTCACGTAAACAATTTGCCAGG + Intronic
929853856 2:45618942-45618964 ACTCATGCAGATTGTTTGCCAGG - Intergenic
932499850 2:72173911-72173933 TTTAATGGACAGAGTTTGCCGGG - Intergenic
935414617 2:102802411-102802433 TCTCCTGGAAACAGGTGGCCTGG - Intronic
937414873 2:121706343-121706365 GCTGTTGGAAATAGTTTGGCAGG + Intergenic
937589013 2:123591431-123591453 TCTCATGGAAAACCTCTGCCAGG - Intergenic
937881252 2:126866490-126866512 TCTCATGGAAAAACTCTGCTAGG - Intergenic
940845779 2:158640617-158640639 TCTCATGTAGGGAGTTTGCCTGG + Exonic
945544340 2:211131221-211131243 ACTGATGGAAAAAATTTGCCTGG - Intergenic
945942844 2:215966893-215966915 TGTAATGGAAAATGTTTGCCAGG - Intronic
946548680 2:220776237-220776259 TCTCCTTGAAATAGCTTGCTGGG - Intergenic
947076723 2:226353047-226353069 TCTCAGGGAACTTGTTTGCTGGG - Intergenic
1178910401 21:36669049-36669071 TCTCCTGGGCAGAGTTTGCCTGG - Intergenic
1182159078 22:28103792-28103814 TTTCATGGAAATAGTATTTCAGG + Intronic
1183885928 22:40882006-40882028 TGTGATGGTAATTGTTTGCCAGG - Exonic
1184940501 22:47761346-47761368 TCTCATTGAAATAGTGCTCCTGG - Intergenic
949116083 3:325429-325451 TCCTATTGAAATAGTTTACCTGG + Intronic
956096632 3:65723047-65723069 CCTCATGGACTTAGGTTGCCCGG + Intronic
956375399 3:68608656-68608678 TCTCATGGAGAAAGTCTGCTAGG - Intergenic
958075142 3:88666728-88666750 TCTCTTGAAAATGGTTGGCCGGG - Intergenic
961140577 3:124552424-124552446 TTTCCAGGAATTAGTTTGCCAGG + Intronic
961764519 3:129198620-129198642 TCACATAGAAATAGATTGCTTGG - Intergenic
965219593 3:165911326-165911348 TCTCATGGATAGAGTTTACATGG - Intergenic
967743815 3:193032270-193032292 TCTCCTGGAAATAATTTCTCAGG + Intergenic
970185843 4:13452332-13452354 TCTCAAGGAAATAGAATGCAAGG - Intronic
974638969 4:64605010-64605032 TCCCTTAGAAATTGTTTGCCTGG + Intergenic
975650861 4:76591389-76591411 TCTCATGAAAATGTTTTCCCAGG - Intronic
976467037 4:85381991-85382013 TCACATGGACATATTTTGCATGG + Intergenic
982686413 4:158495137-158495159 TCTCATGCCTATAGTTTGCATGG - Intronic
982918042 4:161239063-161239085 TATCATGGAACTAGTTTTTCGGG + Intergenic
985149767 4:186934739-186934761 TGTCCTGGAAATAGTTTTCAGGG + Intergenic
987482976 5:18482481-18482503 TCCTATGGAGATAGTTAGCCGGG - Intergenic
988550830 5:32199338-32199360 TTCCATGGAAATAATTTACCTGG - Intergenic
990309628 5:54525443-54525465 TCTGGTGGCAATAGGTTGCCAGG - Intronic
990836392 5:60026205-60026227 TCCCATGGAAATATTTAGCAAGG - Intronic
991412373 5:66357857-66357879 TCCCATTGAATTAGTTTGCTAGG + Intergenic
994096982 5:95856432-95856454 TTTCATGGAAATAGATTTCCAGG + Intronic
994899555 5:105753435-105753457 TCTCATGAAAATAGTTTCTTGGG + Intergenic
995720337 5:115124130-115124152 GCTCTTGGAGATACTTTGCCAGG - Intergenic
997156655 5:131568006-131568028 TCTCATGAATATAGTTTGCCTGG + Intronic
998590544 5:143473177-143473199 TCACATGGAAATCTTTTGTCTGG - Intergenic
999552869 5:152708438-152708460 TCTTATGCAAACAGTTTGCTAGG - Intergenic
999942519 5:156559498-156559520 TCTTGTGGAAATACTTTACCTGG - Intronic
999993947 5:157074051-157074073 TCTCATAGAATAAGGTTGCCTGG - Intergenic
1001500283 5:172226744-172226766 TCTCATGCAAACACTTTGCTAGG + Intronic
1003655173 6:8000339-8000361 TCTCATGGAATTATTTTTTCCGG + Intronic
1003687540 6:8319245-8319267 TATCCTAGAAATAGTTTGCCAGG - Intergenic
1007940028 6:45771854-45771876 TTTCCTGGAAATAGTTTCCACGG - Intergenic
1011950594 6:92959376-92959398 CCTCATGGAAAATGTTTGCTAGG - Intergenic
1014280080 6:119432531-119432553 TGTCATTGAAATAGTCTGGCAGG - Intergenic
1014541382 6:122680300-122680322 TCTCATGCTAATAGTCTGACTGG + Intronic
1014997646 6:128170546-128170568 TCTCAAGTAAATAATATGCCAGG - Intronic
1017160522 6:151361442-151361464 AGTCATTGAAATAGTTTGGCAGG + Intergenic
1017567696 6:155706111-155706133 TCTCAGTGCAATAGTTGGCCTGG - Intergenic
1020931598 7:14403696-14403718 TCACATGTAAATAGTTTCCGAGG - Intronic
1022968045 7:35492705-35492727 GCTCAGTGAAATTGTTTGCCAGG - Intergenic
1023636455 7:42215990-42216012 TCTTATGGGTATAATTTGCCAGG - Intronic
1024516158 7:50259687-50259709 TCTCATGGTTATTGTTTGCATGG - Intergenic
1026376397 7:69755246-69755268 TATCATGGAAATGGTATGCAAGG + Intronic
1026640690 7:72122543-72122565 TCTCATAGAGATAGTTGCCCAGG - Intronic
1028226232 7:88255466-88255488 TCTCTTGGAAGTAGTGTGCCTGG + Intergenic
1028409951 7:90519365-90519387 TCTTTTGGAGATATTTTGCCAGG - Intronic
1030109533 7:106014905-106014927 ACTTATGGAAATAATTTACCAGG - Intronic
1030537857 7:110791388-110791410 TCTCTTTAAAATATTTTGCCAGG + Intronic
1030748861 7:113204564-113204586 TCACATGGGAATAGTTCCCCAGG - Intergenic
1031554960 7:123163147-123163169 TCCCATGGAAATTGTATGCATGG + Intronic
1033543072 7:142375139-142375161 CCGCATGGAAATAGTTTCTCAGG + Intergenic
1036921646 8:12861396-12861418 TCTTCTGGATATAATTTGCCAGG + Intergenic
1040587698 8:48758734-48758756 TCCCAGGGAAATAGCTTTCCAGG - Intergenic
1043677586 8:82977325-82977347 TTTAATGGAAGTAGTTTGCGGGG + Intergenic
1047797637 8:128274077-128274099 TCTCATGGATCCTGTTTGCCTGG - Intergenic
1048484668 8:134835573-134835595 TCCCATGCAAATAGCTTCCCTGG - Intergenic
1050920007 9:11188615-11188637 TGTCATGAAAAAAGCTTGCCTGG - Intergenic
1051032688 9:12701290-12701312 TGTTTGGGAAATAGTTTGCCTGG - Intronic
1051062187 9:13057277-13057299 TCACCTGGAAATAGTTTCTCTGG - Intergenic
1051072064 9:13181993-13182015 TCTCCTTGAAATGGTTTGCAAGG - Intronic
1054736073 9:68751086-68751108 TCTCAGGGAAGAAGTATGCCTGG + Intronic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1060156806 9:121325952-121325974 TCTTCTGGACATAGTTAGCCGGG + Intronic
1061460202 9:130731455-130731477 TCTCATGTTTATAGTTGGCCTGG + Intronic
1062236257 9:135509805-135509827 TCTCATGGTTATGGTTTGCATGG - Intergenic
1187808141 X:23143896-23143918 TCTCCTGGAAATAGGTTTCCAGG - Intergenic
1190776862 X:53559580-53559602 TCTCATGGTAACAGGTTGCAGGG - Intronic
1195412122 X:104578719-104578741 ACTCATGAAAATAATTTTCCTGG - Intronic
1197958428 X:131978098-131978120 TTTCATGCAAACAGTTTGCATGG + Intergenic
1197971488 X:132119704-132119726 TCTGATGTATATAGCTTGCCTGG - Intronic
1200857358 Y:7953406-7953428 TGTCATGGAAATAGTTTCAGGGG + Intergenic