ID: 1081552428

View in Genome Browser
Species Human (GRCh38)
Location 11:44126310-44126332
Sequence AGCACACTGTTAGATGCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081552428 Original CRISPR AGCACACTGTTAGATGCTAT GGG Intronic
906253793 1:44332047-44332069 AGCTCTGTGTTAGATGCTAGGGG - Intronic
906787537 1:48629129-48629151 AGTACATAGTTAGATGCTAGTGG + Intronic
908560432 1:65300908-65300930 AGCACCCTGTTAGGTACAATGGG + Intronic
908949915 1:69547992-69548014 ACCACAGTGATAGATGCTTTAGG + Intergenic
909325377 1:74345382-74345404 ATCACACTGTAATATGGTATTGG - Intronic
909574334 1:77157131-77157153 AGCACTATGTTAGTTGCTTTAGG - Intronic
911209447 1:95123999-95124021 AGCGCAGCGTTAGATGTTATGGG + Intronic
912188543 1:107310397-107310419 AGCACTATGTTAGATGTTGTAGG - Intronic
916160018 1:161901342-161901364 AGCACATTTTTATGTGCTATTGG - Intronic
916898337 1:169191447-169191469 AGTAAACTCTTAGATTCTATAGG - Intronic
917060780 1:171035796-171035818 AGAACTCTGTTATATGCTGTTGG + Intronic
917231619 1:172843823-172843845 ATCACACTGGTAAATGCTAGAGG + Intergenic
919209656 1:194464341-194464363 AGGATGCTGTTAGATGCTATTGG + Intergenic
919997348 1:202765126-202765148 AGCAAACTCTTAGAGGCTAATGG - Intronic
922420456 1:225457489-225457511 AGAGAACTCTTAGATGCTATTGG - Intergenic
923541589 1:234892024-234892046 AGCGCACTGTTAGCTGCTCTTGG - Intergenic
923605110 1:235436332-235436354 AGAACAATGTAAAATGCTATGGG - Intronic
1063136426 10:3220913-3220935 ATCACAGTGCTAGATGTTATGGG + Intergenic
1068169011 10:53369921-53369943 AGCACACTTTAAGATATTATAGG - Intergenic
1068479056 10:57565573-57565595 AGGAAACTGTTATATGCTGTTGG - Intergenic
1070861029 10:79661980-79662002 AGTAGACTGCTTGATGCTATTGG + Intergenic
1070876233 10:79813605-79813627 AGTAGACTGCTTGATGCTATTGG - Intergenic
1074759317 10:116654592-116654614 AGCACTCTGTCGGATGCTGTGGG + Intergenic
1074916983 10:117966913-117966935 AGCACGTTGTAAGATGCAATAGG + Intergenic
1075243089 10:120795649-120795671 AGCACAATACTAGATACTATTGG + Intergenic
1080958374 11:37129033-37129055 TGTAGACTGTTAGATGCAATAGG - Intergenic
1081552428 11:44126310-44126332 AGCACACTGTTAGATGCTATGGG + Intronic
1086676614 11:89615895-89615917 AACACACTGTGAGAGGCTAGAGG - Intergenic
1088035184 11:105303177-105303199 AGGACAATGGCAGATGCTATGGG - Intergenic
1093392584 12:18640699-18640721 ATCACTCTTCTAGATGCTATGGG + Intronic
1093869346 12:24268927-24268949 AGCACACTGTTACATTTTAATGG - Intergenic
1094180081 12:27583277-27583299 GGAACACTGTTAGATGCTTCTGG + Intronic
1095729757 12:45493585-45493607 AGGAAACTGTTAGGTGGTATGGG + Intergenic
1098527865 12:71507326-71507348 ATCACAGTGCTAGGTGCTATTGG - Intronic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1101642709 12:106600110-106600132 AGCACTTTATGAGATGCTATAGG - Intronic
1105428264 13:20314385-20314407 AGCACAATGCTAGGAGCTATGGG + Intergenic
1105581679 13:21703905-21703927 AGCAAATTGTTATATGCTTTTGG + Exonic
1109121552 13:58464105-58464127 TGCACATTGTTAAATGCTACTGG - Intergenic
1110266998 13:73549969-73549991 AGAACTCTGTAAGGTGCTATGGG + Intergenic
1110528820 13:76572424-76572446 AGCACTCTGTAAGATGAAATGGG - Intergenic
1118087028 14:62429426-62429448 AGGTCCCTGTTAGATGCTCTGGG + Intergenic
1118712583 14:68534548-68534570 ACCACACTTTTGGGTGCTATGGG + Intronic
1122446978 14:101776721-101776743 AGCAGACTGGTAGCTGCTAGAGG - Intronic
1128790539 15:70430318-70430340 ATGACACTGTGACATGCTATTGG - Intergenic
1134682689 16:16137408-16137430 AGAATACTGTTAGATGCAATAGG - Intronic
1138643198 16:58402693-58402715 AGCACCCTATTGGATGCTAGGGG - Intronic
1140615138 16:76653976-76653998 AGCACACTGTTAAATGGAAATGG - Intergenic
1143262070 17:5606908-5606930 AGAACTCTGCTAGATGCTGTGGG - Intronic
1144263609 17:13547168-13547190 GACATAGTGTTAGATGCTATGGG - Intronic
1145076303 17:19857806-19857828 AGCATAGTGTTAGATGATACTGG - Intronic
1145180500 17:20746260-20746282 AGGATACTGTTAGATGATCTTGG + Intergenic
1149840098 17:59955251-59955273 AGGATACTGTTAGATGATCTTGG + Intronic
1155379164 18:25199440-25199462 AGCTGATTATTAGATGCTATCGG + Intronic
1157055771 18:44226782-44226804 AGCAAACTGTTAGATGTTGGTGG + Intergenic
1157526690 18:48388417-48388439 AACACACTGCTAGGTGCTGTGGG - Intronic
1158430032 18:57376991-57377013 AGCACACAGTATGATGCTAATGG + Intergenic
1158496239 18:57957465-57957487 AGCACACTTTTAGAGTCTAAGGG - Intergenic
1159188901 18:65016684-65016706 AGTACTATATTAGATGCTATAGG - Intergenic
1160187917 18:76689636-76689658 AGCACATTGCTAGATGCCCTCGG - Intergenic
1164675197 19:30095986-30096008 AGCACAGTGGCAGATGCTAGTGG + Intergenic
1165205932 19:34186110-34186132 AGCACTGTGTTAGATTCTGTGGG + Intronic
926976064 2:18518157-18518179 AACACAGTGTTAGATACTAATGG + Intergenic
929069321 2:38012967-38012989 ATCACACTGCTAGTTGATATTGG + Intronic
930329873 2:49968915-49968937 AGAACACTGCTAGATGTCATGGG - Intronic
931077469 2:58732637-58732659 AACACATTGTTAGATGCTTAGGG + Intergenic
933349170 2:81131157-81131179 AACACTTTGCTAGATGCTATGGG - Intergenic
936057589 2:109272486-109272508 AGCACACAGTTAGAGGCGAAGGG - Intronic
938623372 2:133081643-133081665 AGCACACTTTTACATGCTACAGG + Intronic
938648158 2:133352323-133352345 GGCACAGTGTCAGATGCTAGAGG - Intronic
942297540 2:174532450-174532472 AGCACACTTTTAGATGAAAGGGG - Intergenic
945805226 2:214482239-214482261 TGCATACTATCAGATGCTATTGG - Intronic
946347027 2:219118910-219118932 AGCACACAGACAGATGCTAAAGG + Intronic
946772435 2:223102231-223102253 AGCACCCTGTTTGATGCCAGTGG + Intronic
948771260 2:240252350-240252372 ACCACACAGGTAGCTGCTATGGG - Intergenic
1171096226 20:22334684-22334706 AGCACACTGTTAGAGTGCATCGG + Intergenic
1177207910 21:18031609-18031631 AGCATACTATTAAATGCTACAGG + Intronic
949748156 3:7319352-7319374 AACACACTGTTTGATACTTTTGG - Intronic
953654916 3:44842964-44842986 AGCAGACTGTGACAAGCTATTGG - Intronic
953658254 3:44871229-44871251 AGCACTCTGTGCCATGCTATGGG + Intronic
957182241 3:76893844-76893866 AGCAGAATGATAGATGCTAGAGG - Intronic
962262927 3:133926510-133926532 AGCACCCTGTTAGTTACTAAAGG + Intergenic
966661099 3:182415876-182415898 AGCACTGTTTTAGATGCTGTAGG + Intergenic
968606116 4:1536496-1536518 AGCACACAGGCAGGTGCTATGGG + Intergenic
969119794 4:4899768-4899790 AGAACACTGTTAGGTGCAGTGGG - Intergenic
970372897 4:15426061-15426083 GGCAAACTGTTAGGTGCTCTGGG + Intronic
970876127 4:20872202-20872224 AAAACACTGTAATATGCTATGGG + Intronic
973964721 4:56150031-56150053 AGCACTATATTAAATGCTATGGG + Intergenic
976398373 4:84582320-84582342 AACACAGTGTGAGATGCTATGGG - Intergenic
977887430 4:102269053-102269075 AACACTCTGTTGAATGCTATAGG + Intronic
979460194 4:120973649-120973671 AGGACACTGTTAGTGACTATAGG - Intergenic
982378109 4:154716925-154716947 AGCACTATGCTAGATGCTAGGGG - Intronic
984794610 4:183647374-183647396 AGCTCAATTTTAGATGCTATCGG + Intronic
988673775 5:33410068-33410090 AGCAGACTGTTGGGTGCCATGGG - Intergenic
989518994 5:42378617-42378639 AGCACAAACTTAGATACTATTGG + Intergenic
990137483 5:52664146-52664168 AGCACCTTGTAAGAGGCTATGGG - Intergenic
990561039 5:56983059-56983081 ATCACACTGTTAGGGGGTATGGG + Intergenic
992077339 5:73203567-73203589 AGCACATTGAGAGATGCTGTGGG - Intergenic
992123164 5:73615015-73615037 ACAACACTGTTAGATACTAGAGG - Intergenic
993018203 5:82561228-82561250 AGCACACTCTTAGATGTGCTAGG + Intergenic
994474942 5:100255410-100255432 AGCACATTGTTGTGTGCTATTGG - Intergenic
995667755 5:114563082-114563104 ATCTCACTTTTAGATGTTATTGG + Intergenic
1000067702 5:157709542-157709564 AGCAGTCTGTTAGATGCTTCTGG + Intergenic
1001747528 5:174103174-174103196 AGAAGGCTGTTAGATGCTGTAGG + Intronic
1002872778 6:1182376-1182398 AGCACACTGTGAGAATTTATAGG + Intergenic
1004051359 6:12082966-12082988 AGCACATTGTTAGCTTTTATTGG + Intronic
1006998503 6:38285496-38285518 AGAACACTGTTAGATGGTGGCGG + Intronic
1007827721 6:44613702-44613724 AGAAGACTGTGAGATGCTGTTGG - Intergenic
1008460047 6:51758090-51758112 AGAACATTGTTAGGTGCTATGGG - Intronic
1011890570 6:92154220-92154242 AGCAAACTGAATGATGCTATGGG - Intergenic
1013442979 6:110190564-110190586 AGCATAGTGTTTGATGCTGTGGG + Intronic
1014081605 6:117292823-117292845 ACCACAGAGGTAGATGCTATCGG - Intronic
1014965718 6:127746406-127746428 AGCACTGTGCTAGATACTATAGG - Intronic
1018353223 6:162984836-162984858 AGCCCACTTTTTGATGCGATTGG + Intronic
1024126610 7:46304217-46304239 TGCACAATGTTTGAAGCTATTGG + Intergenic
1024617705 7:51129552-51129574 AGCACAGTGTTAGACACTGTAGG + Intronic
1029799349 7:102929967-102929989 AACACACTCTTCAATGCTATCGG - Intronic
1031565162 7:123287273-123287295 AGGAAACTGTTATACGCTATTGG - Intergenic
1034836370 7:154355108-154355130 AGCACCTTTTTAGATGCTATTGG + Intronic
1036521635 8:9496889-9496911 CGGACACTTTTAGATACTATTGG + Intergenic
1042055165 8:64756641-64756663 AGCAGATTGTGAGATGCTAGCGG - Intronic
1043972287 8:86544911-86544933 AGTAAACCGTTTGATGCTATGGG - Intronic
1047294131 8:123556273-123556295 GGCACAGTGTGAGAGGCTATGGG + Intergenic
1050143262 9:2538653-2538675 AGGGAACTGTTAGATGCTGTGGG - Intergenic
1051185909 9:14461107-14461129 AGAACAGTGTGGGATGCTATGGG - Intergenic
1061837543 9:133339395-133339417 AGCACACTGTGAGAACCAATGGG + Exonic
1195483697 X:105377598-105377620 AGCACTTTGCTAGATACTATTGG + Intronic
1195869863 X:109474641-109474663 AGCACACAGTTAGTTGATATGGG - Intronic
1196107877 X:111915730-111915752 AGCACTGTGCTAGATGCCATAGG - Intronic
1196536033 X:116845534-116845556 GGTACACTGTTATATGCTATGGG + Intergenic
1196732378 X:118953839-118953861 AGCACAGTGCTAGGTGATATAGG + Intergenic
1199293717 X:146134094-146134116 AGCTCACTTTCAGAAGCTATGGG - Intergenic