ID: 1081554180

View in Genome Browser
Species Human (GRCh38)
Location 11:44142829-44142851
Sequence TATTCTAAGCTGAAGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081554180 Original CRISPR TATTCTAAGCTGAAGGGAGC AGG (reversed) Intronic
900960271 1:5914764-5914786 CTTCCTAGGCTGAAGGGAGCAGG + Intronic
901164809 1:7211695-7211717 CATTCTCTGCTGAAAGGAGCCGG - Intronic
901300972 1:8200036-8200058 TATGTTGAGCTGAATGGAGCAGG + Intergenic
903258056 1:22115778-22115800 CATTGTAAGTTGAAGAGAGCAGG - Intergenic
905140910 1:35843416-35843438 TAATCTAAGCTGATTGGATCTGG - Intronic
905844192 1:41213388-41213410 TATTTTAAGCTGAAGGAATGTGG + Intronic
906064461 1:42970358-42970380 TTTTCTAAGATGAGAGGAGCTGG + Intergenic
906127001 1:43432824-43432846 GACTCTAAGCTGATGGGAGGTGG + Intronic
906863482 1:49389162-49389184 CATTCTTAGCTGAAGGAAGGAGG - Intronic
908731250 1:67228822-67228844 TCTTATAAGCAGAAGGGAGAAGG - Intronic
912872887 1:113326316-113326338 TATTCTCAGCTGAAGAGAGATGG - Intergenic
913314802 1:117540781-117540803 TATTCTAAGCTGAAGTGGTGAGG - Intergenic
913975584 1:143452000-143452022 TAAGCTCAGCTGAAGGCAGCTGG + Intergenic
914069978 1:144277617-144277639 TAAGCTCAGCTGAAGGCAGCTGG + Intergenic
914109177 1:144688737-144688759 TAAGCTCAGCTGAAGGCAGCTGG - Intergenic
914513290 1:148352997-148353019 TATAGAAAGCTGGAGGGAGCTGG + Intergenic
916850668 1:168700220-168700242 TAAAATAAGTTGAAGGGAGCTGG + Intronic
917016455 1:170536933-170536955 TTTTCTGAGGTGGAGGGAGCAGG + Intronic
920382143 1:205541358-205541380 AAGTCTAAGCTCAAGGCAGCAGG - Intergenic
1062876202 10:944710-944732 AACTCAAAGCTGAAGGCAGCAGG - Intergenic
1063230418 10:4060722-4060744 GTTTCTAAGCTGGAGGGATCAGG - Intergenic
1063744662 10:8867101-8867123 TATTGTAAACTAAGGGGAGCAGG - Intergenic
1064301443 10:14126602-14126624 TATTCTATGCAGATGGGAGAAGG - Intronic
1064902125 10:20306893-20306915 TATTCTAAGCAGAAAGCAGCAGG + Intergenic
1067183542 10:44008055-44008077 CATTCTAAAATGAAGGGAGGAGG + Intergenic
1067423706 10:46184159-46184181 TATACTTTGCTGAAGGGAGGAGG - Intergenic
1070420227 10:76229086-76229108 AATTCTAAGGAGAATGGAGCTGG + Intronic
1071644188 10:87344369-87344391 TATACTTTGCTGAAGGGAGGAGG + Intergenic
1072026676 10:91467063-91467085 GAAGCTGAGCTGAAGGGAGCTGG + Intronic
1072222424 10:93337807-93337829 TATTCCAAGCTCAAGGTACCTGG - Exonic
1072755901 10:98020684-98020706 TGTTCCAGGCTGAGGGGAGCAGG + Intronic
1073840018 10:107487825-107487847 TATTTTAAGCAGATGTGAGCTGG - Intergenic
1076459460 10:130630844-130630866 TATTCTAAGTTCATGGGTGCTGG + Intergenic
1076672352 10:132130266-132130288 CATTCTAAGCTCTTGGGAGCTGG + Intronic
1080649388 11:34210086-34210108 TCTTCCAAGCTGACGGAAGCTGG + Intronic
1081554180 11:44142829-44142851 TATTCTAAGCTGAAGGGAGCAGG - Intronic
1085140168 11:74132902-74132924 TATTCTCAGTTGAAGGGAGGAGG + Exonic
1091140842 11:133233307-133233329 TATTTTGAGCTGAAGGAAACTGG + Intronic
1092818551 12:12332021-12332043 AATTCTAAGCTTCATGGAGCAGG - Intronic
1093150016 12:15609734-15609756 TCTTCTCAACTGAAGGGATCTGG - Intergenic
1095155593 12:38850050-38850072 TTTTCTAATCTGAAGGGAGTGGG + Intronic
1100279935 12:93108633-93108655 TATTCTAATCTGTTGGGGGCAGG + Intergenic
1102203711 12:111075684-111075706 TATTCTAGGCTGAGGGAATCAGG + Intronic
1102551792 12:113696676-113696698 TGTTCAAAGCTGAAGGGATTTGG + Intergenic
1102621676 12:114200811-114200833 AGTTCTAAGCTGCAGTGAGCTGG + Intergenic
1103349840 12:120276544-120276566 TTTTCTCAGGTGAAGGGGGCTGG + Intergenic
1106471977 13:30064211-30064233 TATTTTAAGCTGAAGGCATGTGG - Intergenic
1108328277 13:49357136-49357158 TGTTCAAATGTGAAGGGAGCGGG - Intronic
1113614234 13:111669632-111669654 TCCTCTAGGCTGAAGGGTGCTGG + Intronic
1113619702 13:111754546-111754568 TCCTCTAGGCTGAAGGGTGCTGG + Intergenic
1114344411 14:21780620-21780642 TCTACAGAGCTGAAGGGAGCCGG + Intergenic
1116261222 14:42629820-42629842 AATTCTAAGGTAAAGAGAGCAGG - Intergenic
1119381348 14:74230995-74231017 TCTTCTAGGATGAAGGAAGCTGG + Intergenic
1121681637 14:95797640-95797662 TGTTCTAAGCTGTTGGGAGCAGG + Intergenic
1122859348 14:104575582-104575604 TTATCTCAGCTGATGGGAGCTGG + Intronic
1125072873 15:35576672-35576694 CATTCTAAGCCGCAGTGAGCTGG + Intergenic
1127768312 15:62209417-62209439 CTTGCTAAGCTGCAGGGAGCAGG + Intergenic
1131397830 15:92100772-92100794 TATTCTAAGCTGCTGAGAGTTGG - Intronic
1132279095 15:100597000-100597022 TATTCTATGATGAAAGGAGAGGG - Intronic
1135572134 16:23557545-23557567 TTTCCCAAGCTGAAGGGGGCGGG - Exonic
1136057163 16:27698976-27698998 TGCTCAAAGCTGAAGGCAGCAGG - Intronic
1140376490 16:74449187-74449209 TAATCTAAGAAGAAGGAAGCTGG - Intergenic
1141461990 16:84183245-84183267 AATTTCAAGCTGGAGGGAGCGGG - Exonic
1148534504 17:48428437-48428459 TAATCTAAGCTAAAGGAAGGTGG + Intronic
1152886511 17:82854314-82854336 TTATCAAAGCTGAAGGGGGCTGG - Intronic
1152911155 17:83005640-83005662 TTTCCTGAGCTGAATGGAGCAGG - Intronic
1155678273 18:28457524-28457546 TACCCTAAGCTGAAGCCAGCCGG + Intergenic
1162207567 19:9067177-9067199 TATTCTAAGTTGATAGGTGCTGG - Intergenic
929834700 2:45384735-45384757 TCATTTAAGCTGAGGGGAGCGGG - Intergenic
930978682 2:57495662-57495684 TATGCAAAGCTGAAGGGAAAGGG - Intergenic
934180282 2:89612972-89612994 TAAGCTCAGCTGAAGGCAGCTGG + Intergenic
934290582 2:91687235-91687257 TAAGCTCAGCTGAAGGCAGCTGG + Intergenic
936462152 2:112721915-112721937 TATTGGGAGCTGGAGGGAGCAGG + Intronic
939114112 2:138041069-138041091 TTGTCTCAGCTGAATGGAGCCGG + Intergenic
941303476 2:163831190-163831212 TATTCTAACATGGAGGGAGGTGG - Intergenic
945510034 2:210689634-210689656 TATTCCAAGCTGTTGGCAGCTGG + Intergenic
946473849 2:219988912-219988934 TATCCTCTCCTGAAGGGAGCAGG + Intergenic
1172277021 20:33685514-33685536 AATTCTGAGCTGAAGCCAGCAGG + Intronic
1172994413 20:39059440-39059462 CATTCTAAGCTGGAGGGAGGAGG - Intergenic
1174519451 20:51118478-51118500 TTTGCTAAGCTGAAGGGACAGGG - Intergenic
1177191877 21:17861153-17861175 TATTCTAGGCAGAAAGGACCAGG + Intergenic
1179468513 21:41594839-41594861 TATTTTAAGCTGGAGGAAGCTGG - Intergenic
1181366652 22:22381568-22381590 TGTCCTAAGCTGCAGGGAGGAGG - Intergenic
950012037 3:9731056-9731078 GATGCGACGCTGAAGGGAGCAGG - Intergenic
951969451 3:28427795-28427817 TATTTTATGCTGAATGGAGTAGG + Intronic
953477393 3:43217378-43217400 CAAGCTAAGCTGAAGGGAGGAGG - Intergenic
954761355 3:52876940-52876962 TATTCTACACTGAAGGTAGGTGG + Intronic
955611349 3:60760579-60760601 CGTTTTAAGCTGACGGGAGCAGG - Intronic
956072842 3:65472723-65472745 GGGTCTAGGCTGAAGGGAGCTGG + Intronic
957315683 3:78573107-78573129 TATTTTAAGCTGAAGGTATTGGG - Intergenic
958728306 3:97932910-97932932 TATTTTTAGCAGAAGGGAGCAGG - Intronic
959500779 3:107103701-107103723 TTTTCTAAACAGAAGAGAGCTGG - Intergenic
959685890 3:109145903-109145925 TATTCTAGGCTGAAGGAGACTGG - Intergenic
961965304 3:130895012-130895034 TTCCCTAAGCTGAAGAGAGCAGG - Intronic
962503419 3:136019210-136019232 AATTATATGCTGCAGGGAGCAGG + Intronic
962796988 3:138858160-138858182 TATTCCTAGGTGCAGGGAGCTGG - Intergenic
963158285 3:142122801-142122823 TATTCTAATATGAAGAGATCTGG + Intronic
963512902 3:146271307-146271329 TATTCTAACCTGAATGCTGCAGG - Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966283432 3:178263723-178263745 TAGTCTAAGCTGCAGAGAGATGG - Intergenic
966363158 3:179151249-179151271 TATTCTAATCTGAAGTCAGTTGG + Intronic
969828998 4:9780665-9780687 TAAGCTCAGCTGAAGGCAGCTGG - Intronic
970558974 4:17264159-17264181 TTTTCTAAAATGAAGGGGGCAGG - Intergenic
972584820 4:40428121-40428143 AATTCAAAGCTGCAGTGAGCTGG + Intronic
975883740 4:78940536-78940558 TATTCTGGGCTGAAGTGAGAGGG + Intergenic
975918924 4:79359358-79359380 TGCTCTATGCTGAAGGGAACTGG + Intergenic
976084492 4:81393673-81393695 TATTCAAACCTAAAGGCAGCTGG + Intergenic
977873577 4:102123298-102123320 TATGCTAAGCTGCCTGGAGCTGG + Intergenic
978277529 4:106969689-106969711 CTTTCTAAACTGAAGAGAGCAGG + Intronic
980516442 4:133868391-133868413 TATGATAAGCTTAATGGAGCAGG - Intergenic
983693145 4:170497155-170497177 TATTTTAGGCTGAAGTGTGCGGG + Intergenic
986145193 5:5071404-5071426 TCTTCTAAGGTGGAGGGAGGTGG + Intergenic
987847225 5:23302366-23302388 TTTTCTAATCAGAAGAGAGCTGG - Intergenic
988874209 5:35425799-35425821 TATACTAAGCTGGAGGGAAGAGG + Intergenic
992385466 5:76280382-76280404 GATTCTAAGCTGAGCAGAGCTGG + Intronic
996170914 5:120290292-120290314 TATTTTAGACTGAAGGGATCAGG + Intergenic
997094185 5:130892153-130892175 TATTCTAAGCAGAAAGAACCGGG + Intergenic
997526161 5:134554635-134554657 TGTGCTAAGCTGACGTGAGCTGG + Intronic
998515789 5:142752754-142752776 GATTCTAATCTGAATGAAGCAGG + Intergenic
999130535 5:149279767-149279789 TATTCAAAGCTGCAAGGAGCAGG - Intronic
999391103 5:151191774-151191796 TATTCTAAGCTGAAGAAATCAGG + Intronic
1001044043 5:168357713-168357735 TGTTCTGAGCTGAAGGCGGCTGG - Intronic
1002927422 6:1612519-1612541 TATCCTATGTTGAAGGGAGGGGG + Exonic
1004684650 6:17931194-17931216 TATTCTAAGGTCACGAGAGCTGG + Intronic
1004893040 6:20120215-20120237 CATTTTATGCTCAAGGGAGCAGG - Intronic
1006486300 6:34345361-34345383 TTTTAAAAGCTGAAGGGAGTCGG + Intronic
1007566133 6:42851979-42852001 TAATCTAACCTGAAGGTACCAGG + Intronic
1008481205 6:51987271-51987293 TATTCAAAGCTGAAGGTATGAGG + Intronic
1012562008 6:100594137-100594159 TATGATTAGCTGAAGGGAGCTGG + Intronic
1015863539 6:137705064-137705086 TTTTCTAATCAGAAGAGAGCTGG - Intergenic
1016357712 6:143236021-143236043 TATTTTAAGCTGAAGGAATTTGG - Intronic
1016696358 6:147000699-147000721 TATTCTAAGCCGAGGAGAGGAGG + Intergenic
1017194169 6:151682400-151682422 TATTCTGAGCTGCCGGGAGCTGG + Intronic
1017998965 6:159561260-159561282 AATTCTAGGCAGAAGGGGGCGGG - Intergenic
1019410419 7:904311-904333 TCGTCCAAGCTCAAGGGAGCAGG + Intronic
1019935837 7:4257143-4257165 TGGTCTAAGCTGGTGGGAGCAGG - Intronic
1020727465 7:11833236-11833258 TATTATTAGCTAAAGGGAGAAGG - Intergenic
1022653001 7:32294117-32294139 GAGGCTAAGCTGAAGGGAGGAGG - Intronic
1028656815 7:93218247-93218269 GATTTTAAGCTGAAGGAGGCAGG + Intronic
1031177282 7:118369171-118369193 TAATCTAATCTCAAGAGAGCTGG - Intergenic
1031591447 7:123597182-123597204 TGTTCTAAGCAGAACAGAGCAGG - Intronic
1032757553 7:134905515-134905537 AATGCTAAGCTGGAGAGAGCAGG - Intronic
1033262040 7:139852302-139852324 GATTATAAGTTGCAGGGAGCAGG + Intronic
1033447676 7:141436781-141436803 TATTTTTAGCAGAAGGGAGAGGG - Intronic
1037289299 8:17334680-17334702 AGTTCTAAGCTGAAGGCAACAGG - Intronic
1037606595 8:20442983-20443005 AATTTTAAGATCAAGGGAGCAGG + Intergenic
1040738137 8:50536412-50536434 TATTTTAAAATGAGGGGAGCTGG - Intronic
1043196986 8:77307667-77307689 TAATATAAGGTGAAGGGAGGTGG + Intergenic
1045571813 8:103375462-103375484 TATAATGAGCAGAAGGGAGCAGG + Intronic
1048856888 8:138693802-138693824 TATTCCAAACTGAAGGGGCCCGG + Intronic
1049539615 8:143202138-143202160 TATTCAAACCTGAAAGGAGGAGG + Intergenic
1056488919 9:87085980-87086002 TCCTCTAAGCTGAAAGGTGCCGG - Intergenic
1056608553 9:88108770-88108792 TATTGAGAGGTGAAGGGAGCAGG + Intergenic
1057733305 9:97630954-97630976 TATTTGAAGCTGAAGCTAGCTGG - Intronic
1058954574 9:109933628-109933650 TCTTCAAAGATAAAGGGAGCTGG - Intronic
1186055066 X:5641591-5641613 CCTTCTAAGCTGAAGGCAGGAGG - Intergenic
1191998309 X:67120885-67120907 GATTCTAGCCTGAAGGAAGCTGG + Intergenic
1192596097 X:72410021-72410043 AATTTTAAGCACAAGGGAGCTGG + Intronic
1194937853 X:99972533-99972555 TATTCTAAGCAGAAGGACGGAGG - Intergenic
1195115881 X:101697137-101697159 TATTCTGAGCTGCCTGGAGCTGG - Intergenic
1198162104 X:134018164-134018186 TATTCTTTGATGAGGGGAGCTGG + Intergenic