ID: 1081554551

View in Genome Browser
Species Human (GRCh38)
Location 11:44146271-44146293
Sequence GTTACATTTTGAGATGCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 687
Summary {0: 1, 1: 1, 2: 12, 3: 111, 4: 562}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081554544_1081554551 27 Left 1081554544 11:44146221-44146243 CCTCATTTTCACTTAATCACCTC 0: 3
1: 76
2: 316
3: 909
4: 1726
Right 1081554551 11:44146271-44146293 GTTACATTTTGAGATGCTAGGGG 0: 1
1: 1
2: 12
3: 111
4: 562
1081554546_1081554551 8 Left 1081554546 11:44146240-44146262 CCTCTTTGAAAAGGCCCTTTCTC 0: 1
1: 2
2: 1
3: 42
4: 271
Right 1081554551 11:44146271-44146293 GTTACATTTTGAGATGCTAGGGG 0: 1
1: 1
2: 12
3: 111
4: 562
1081554547_1081554551 -6 Left 1081554547 11:44146254-44146276 CCCTTTCTCTAAATACAGTTACA 0: 2
1: 6
2: 126
3: 667
4: 1922
Right 1081554551 11:44146271-44146293 GTTACATTTTGAGATGCTAGGGG 0: 1
1: 1
2: 12
3: 111
4: 562
1081554548_1081554551 -7 Left 1081554548 11:44146255-44146277 CCTTTCTCTAAATACAGTTACAT 0: 1
1: 7
2: 117
3: 733
4: 1908
Right 1081554551 11:44146271-44146293 GTTACATTTTGAGATGCTAGGGG 0: 1
1: 1
2: 12
3: 111
4: 562

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081554551 Original CRISPR GTTACATTTTGAGATGCTAG GGG Intronic
900754377 1:4423509-4423531 GTCACATTCTCAGATACTAGCGG - Intergenic
900768093 1:4519012-4519034 GTCACATTCTGACATGCTGGGGG - Intergenic
900824349 1:4914065-4914087 GTCACATTTTGAGGTACTGGGGG + Intergenic
902116902 1:14128669-14128691 GTCACATTATGAGATACTGGGGG + Intergenic
902759081 1:18569169-18569191 GTCACATTCTGAGATTCTGGGGG + Intergenic
903504635 1:23824946-23824968 GTTGCTTTTAGAGATGCTTGGGG - Intronic
904271383 1:29352657-29352679 GTCACATTCTGAGGTACTAGAGG + Intergenic
904778820 1:32929369-32929391 GGCACATTTTGAGGTACTAGGGG + Intergenic
905194530 1:36265064-36265086 GTTACATTCTGAGGTACTAGGGG + Intronic
906670890 1:47653827-47653849 GTCACATTTTGAGGTACTTGGGG + Intergenic
906999313 1:50833829-50833851 TTTACAATTTGAGATGGTAAGGG - Intronic
907703580 1:56813608-56813630 GTCACATTCTGAGGTGCTGGGGG + Intronic
908825808 1:68131722-68131744 GTCACATTCTGAGGTTCTAGGGG - Intronic
908925025 1:69243764-69243786 GTCACATTTTAAGATACCAGAGG - Intergenic
909385787 1:75054728-75054750 GCTATATTTTTAGATACTAGAGG - Intergenic
910021522 1:82595842-82595864 GATATATTTTAAGGTGCTAGTGG - Intergenic
910652879 1:89588892-89588914 TTTACATTTTTAGATGGTTGGGG + Intronic
911077953 1:93897640-93897662 GTCATATTTTGATATGCAAGAGG - Intronic
911437541 1:97881147-97881169 GCTACATTTTGAGATAGTGGGGG - Intronic
912405064 1:109430805-109430827 GTCACATTCTGAGATACTGGGGG - Intergenic
913160377 1:116139798-116139820 GTCACATTCTGAGGTGCTGGGGG - Intergenic
913648410 1:120884965-120884987 GATACATTTTGTGATACAAGAGG - Intergenic
913700585 1:121370253-121370275 GTTAAATTTTGAGATGGTCTAGG - Intronic
914041136 1:144050704-144050726 GTTAAATTTTGAGATGGTCTAGG - Intergenic
914078284 1:144378324-144378346 GGTACATTTTGTGATACAAGAGG + Intergenic
914100895 1:144588177-144588199 GGTACATTTTGTGATACAAGAGG - Intergenic
914136952 1:144909765-144909787 GTTAAATTTTGAGATGGTCTAGG + Intronic
914173192 1:145246858-145246880 GGTACATTTTGTGATACAAGAGG + Intergenic
914298085 1:146349460-146349482 GGTACATTTTGTGATACAAGAGG + Intergenic
914527847 1:148487994-148488016 GGTACATTTTGTGATACAAGAGG + Intergenic
914638542 1:149579068-149579090 GGTACATTTTGTGATACAAGAGG - Intergenic
916023196 1:160812343-160812365 GTCACATTCTGAGGTGCTAGAGG + Intronic
917040184 1:170797135-170797157 GCTACATTCTGAGATACTACTGG - Intergenic
917505438 1:175623030-175623052 GTTACATTTTGAGGTACTGAGGG + Intronic
917640787 1:176981392-176981414 GTAACATTTTGAAGTACTAGGGG - Intronic
918220125 1:182429128-182429150 GTTATATTCTGAGGTACTAGAGG + Intergenic
918387119 1:184020771-184020793 GTTACTGTTTGAGATGCTGGTGG - Intronic
918511831 1:185320762-185320784 GTCATATTTTGAGATACTGGGGG + Intergenic
918551447 1:185747013-185747035 GTCACATTTTGAGGTGCTGGAGG + Intronic
918975981 1:191487402-191487424 GTTCAATTTAGATATGCTAGAGG + Intergenic
919020540 1:192099678-192099700 GTTACATTCTGAGGTACTAGTGG - Intergenic
919251634 1:195064240-195064262 GTCACATTCTGAGGTACTAGGGG - Intergenic
919315070 1:195962163-195962185 TTTACATTTTGAAATGTCAGAGG + Intergenic
920007238 1:202842333-202842355 GTCACATTCTGAGATACTGGGGG + Intergenic
920488000 1:206388980-206389002 GTTAAATTTTGAGATGGTCTAGG - Intronic
920911084 1:210217448-210217470 GTCACATTCTGAGACACTAGGGG - Intergenic
921216891 1:212945391-212945413 GTTACATTGTGAAGTGCTAGGGG + Intergenic
921266000 1:213421072-213421094 GTCACATTTTGAGGTACTAGGGG + Intergenic
921887988 1:220325566-220325588 CTTACATTTTGTGATACTTGTGG + Intergenic
921992511 1:221382789-221382811 GTTTCATTTAGAGATCCTGGAGG - Intergenic
922422571 1:225469688-225469710 GTTATATTTTGAGGTCCTGGGGG - Intergenic
923052476 1:230398499-230398521 GTCACATTTTGAAGTACTAGGGG + Intronic
923103400 1:230835733-230835755 GTCACATTCTGAGATACTGGGGG - Intergenic
923144235 1:231186697-231186719 GTCACATTCTGAGGTGCTGGGGG + Intronic
923492626 1:234497951-234497973 GTTACATTCAGAGGTACTAGGGG - Intergenic
923768479 1:236915255-236915277 GTCACATTCTGAGGTGCTGGGGG - Intergenic
924037673 1:239953659-239953681 CTTACATATTGTGATGCTATGGG - Intergenic
924246553 1:242091216-242091238 GTTACATTCTGAGGTACTGGGGG + Intronic
924757073 1:246951244-246951266 GTCACATTCTGAGATACTGGGGG - Intronic
924796879 1:247299167-247299189 GTCACATTCTGAGGTACTAGAGG - Exonic
1062822458 10:545067-545089 GTGACATTTTGAGTTTCTAGGGG - Intronic
1063016591 10:2084041-2084063 GTCACATTCTGAGATGCTAGAGG - Intergenic
1064005133 10:11693312-11693334 GTCACATTCTGAGGTGCTAGGGG + Intergenic
1065371999 10:24996847-24996869 GTTATATTCTGAGATACTGGGGG - Intronic
1065789946 10:29251453-29251475 CTTACATTTAGAGATGCATGGGG - Intergenic
1065812013 10:29450992-29451014 GTCACATTCTGAGGTACTAGGGG + Intergenic
1066405113 10:35110871-35110893 GTTACATTCTGAGGTACTAGAGG + Intergenic
1067172985 10:43922776-43922798 GCTACATTCTGAGATGCTGGGGG - Intergenic
1067204432 10:44200960-44200982 GTCACATTCTGAGCTACTAGGGG - Intergenic
1067215544 10:44299822-44299844 GTCACATTCTGAGGTGCTAGGGG + Intergenic
1067735526 10:48847337-48847359 GTCACATTCTGAGGTACTAGGGG + Intronic
1067788265 10:49268503-49268525 GTCACATTCTGAGATACTAGAGG + Intergenic
1068024508 10:51626478-51626500 GTTATTTTTTGAAATCCTAGGGG + Intronic
1068133112 10:52920144-52920166 GTCACATTTTGAGATACTAGGGG - Intergenic
1068266144 10:54652541-54652563 GTTACATTCTGAGTTACTAGGGG - Intronic
1068467576 10:57414738-57414760 GTTAAATTTTGAAATGCTTTTGG - Intergenic
1069152451 10:64981254-64981276 GTCACAGTTTTAGAGGCTAGAGG - Intergenic
1070390058 10:75962121-75962143 GTTACATTCTGAGGTACCAGGGG + Intronic
1070872601 10:79770125-79770147 GTCACATTCTGAGATACTGGGGG + Intergenic
1071237017 10:83660976-83660998 GTCACATTCTGAGATACTTGGGG - Intergenic
1071639523 10:87292274-87292296 GTCACATTCTGAGATACTGGGGG + Intergenic
1071655712 10:87445678-87445700 GTCACATTCTGAGATACTGGGGG - Intergenic
1072224997 10:93360879-93360901 GTCAGGTTTTGAGATGCTTGGGG - Intronic
1073529725 10:104219967-104219989 GTCACATTCTGAGGTGCTGGGGG - Intronic
1073620107 10:105037739-105037761 GTCACATTCTGAGATGCTAGAGG + Intronic
1074501895 10:114033161-114033183 GTCACATTTTGAAATACTAGGGG - Intergenic
1077751549 11:4976081-4976103 GTTACTTTTAGAGACTCTAGAGG + Intronic
1077795359 11:5485863-5485885 GTCACATTCTGAGATGCTGAGGG - Intronic
1077844386 11:6009064-6009086 ATTACATTAACAGATGCTAGGGG - Intergenic
1078467706 11:11562430-11562452 GTTACATTCTGAGGTATTAGGGG + Intronic
1078868410 11:15320819-15320841 GTCACATTTTGAGGTATTAGAGG - Intergenic
1078942538 11:16023984-16024006 GTCACATTCTGAGGTACTAGGGG - Intronic
1079284088 11:19113784-19113806 GTTACATTCTGAGGTACTGGGGG - Intergenic
1079449074 11:20583722-20583744 GTCACATTTTGAGGTACTGGGGG + Intergenic
1079820899 11:25126738-25126760 GTTACATTCTGAGGTACTAGGGG + Intergenic
1080252330 11:30247733-30247755 GTTACATTATAGGATGTTAGAGG - Intergenic
1080253152 11:30258527-30258549 GTTACATTCTGAGGTACTGGAGG - Intergenic
1081155423 11:39683985-39684007 GTTACATTCTGAGTTACTAGAGG - Intergenic
1081518006 11:43852403-43852425 GTAAGATTTTGAGCTTCTAGAGG - Intronic
1081554551 11:44146271-44146293 GTTACATTTTGAGATGCTAGGGG + Intronic
1081826421 11:46058045-46058067 GTTAAAAGTTGAGATGTTAGGGG - Intronic
1082224895 11:49693444-49693466 GTTATCTTTTAACATGCTAGTGG + Intergenic
1082962402 11:58931368-58931390 GTCACATTTTGAGGTACTAGGGG + Intronic
1083055980 11:59820223-59820245 GTTACATTCTGAAGTGCTAGGGG + Intergenic
1084447672 11:69213110-69213132 GTTACATTCTGAGGTTCCAGGGG - Intergenic
1085185832 11:74575464-74575486 GTTACATTCTGAGGTCCTGGAGG + Intronic
1085531837 11:77196401-77196423 GTTACATTCTGAGTTGCTGGGGG + Intronic
1086367462 11:86122085-86122107 GTCACATTTTGAGGTACTAAGGG + Intergenic
1086429769 11:86725434-86725456 GTCACATTCTGAGGTGCTGGAGG - Intergenic
1086472857 11:87134361-87134383 GTTACATTCTGAGATATTGGGGG + Intronic
1086798887 11:91145468-91145490 GTTACATTTTGAGGAACCAGGGG + Intergenic
1087617566 11:100505977-100505999 GTCACATTTTGAGGTCCTGGAGG - Intergenic
1088158070 11:106833272-106833294 GTTACATTCAGAGATACTGGGGG + Intronic
1088885591 11:114003886-114003908 GTCACATTCTGAGGTGCTGGAGG - Intergenic
1089166926 11:116484507-116484529 GTCCCATTCTGAGATGCTGGAGG - Intergenic
1089849939 11:121487213-121487235 GTTAGATTTTGAGCTACTTGAGG + Intronic
1091062377 11:132475415-132475437 GTCATATTCTGAGATGCTGGAGG - Intronic
1091470630 12:723618-723640 GTCACATTCTGAGATACTGGGGG - Intergenic
1091854902 12:3731656-3731678 GTCACATTCTGAGGTACTAGGGG - Intronic
1092523055 12:9292872-9292894 GCCACATTCTGAGATGCTGGGGG + Intergenic
1092544236 12:9439025-9439047 GCCACATTCTGAGATGCTGGGGG - Intergenic
1092654609 12:10671950-10671972 GTTACATTATGAGTTACTGGGGG - Intronic
1092656998 12:10696324-10696346 GTTACATTCTGAGGTACTGGAGG + Intergenic
1093184404 12:16003358-16003380 GTCACATTCTTACATGCTAGGGG + Intronic
1093755108 12:22843389-22843411 GTTACATTCTGAGGTACTGGGGG + Intergenic
1094508710 12:31083043-31083065 GCCACATTCTGAGATGCTGGGGG + Intronic
1095518743 12:43037076-43037098 GTCACATTCTGAGATTCTGGTGG - Intergenic
1095674963 12:44905903-44905925 GCTACATTCTGAGAGTCTAGGGG + Intronic
1096212913 12:49780108-49780130 GTCACATTCTGAGATACTGGGGG + Intergenic
1097445872 12:59670326-59670348 GTCACATTCTGAGATACTGGAGG + Intronic
1097635525 12:62116820-62116842 GTTACATTTTGAGGAACTAGGGG - Intronic
1097708530 12:62893834-62893856 GTCACATTCTGAGGTACTAGGGG + Intronic
1097788151 12:63783854-63783876 GTTACTTTTTGAGGCTCTAGAGG + Intronic
1097945224 12:65360195-65360217 GTCACATTCTGAGATATTAGGGG + Intronic
1098664622 12:73146643-73146665 GTAACATTCTGAGGTACTAGGGG + Intergenic
1098849495 12:75578254-75578276 GACACAATTTGAAATGCTAGAGG - Intergenic
1099070578 12:78041571-78041593 TTTACATTTTGACCTGCTACTGG + Intronic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1099319381 12:81125790-81125812 GTTTAAATTTGAGACGCTAGTGG - Intronic
1099415413 12:82379178-82379200 GTGACATTTTGAGGTGCTGTGGG + Intronic
1099734125 12:86545154-86545176 TTTACATTTTAATATGCCAGAGG - Intronic
1100171375 12:91978521-91978543 GTCACATTCTGAGATACTAGGGG + Intergenic
1100658577 12:96672957-96672979 GTTACATTTGGAAAGGCAAGAGG + Intronic
1100729841 12:97452869-97452891 GTGGCATTATGAAATGCTAGAGG - Intergenic
1101343363 12:103862924-103862946 ATCACATTCTGAGATACTAGGGG - Intergenic
1101414440 12:104497178-104497200 GTGACATTTTGAGGTACTGGGGG - Intronic
1101439548 12:104693225-104693247 GTTACATTCTGAAGTGCTGGGGG + Intronic
1101702924 12:107192145-107192167 GTCACATTCTGAGATTCTTGGGG + Intergenic
1102596167 12:113994060-113994082 GTGACATTTTGAGATACTGGGGG - Intergenic
1103525787 12:121567300-121567322 GCTACATTCTGAGGTGCTGGGGG - Intronic
1104073989 12:125373317-125373339 GTCACATTTTGAGGTCCTGGAGG - Intronic
1104698622 12:130883749-130883771 GTCACATTTTGAGATTAAAGGGG + Intergenic
1105310125 13:19199142-19199164 GTTACATTCTGAGGTGATGGAGG - Intergenic
1105527346 13:21188129-21188151 GTTACATTCTGAGGTGATGGAGG + Intergenic
1106078672 13:26482589-26482611 GTCACATTCTGAGGAGCTAGGGG + Intergenic
1106171741 13:27294605-27294627 GTCACATTCTGAGGTGCTGGGGG - Intergenic
1106437816 13:29739332-29739354 GTTACATTCTGAGGGACTAGGGG + Intergenic
1106625927 13:31420932-31420954 GTTACATTCTGAGGTACTGGGGG + Intergenic
1107500119 13:40964951-40964973 GTTACACTCTGAGGTACTAGAGG + Intronic
1107687654 13:42920163-42920185 GTCACATTCTGAGGTGCTAGGGG + Intronic
1107875435 13:44786864-44786886 GTCACATTCTGAGGTGCTAGGGG - Intergenic
1107995558 13:45856731-45856753 GTCACATTCTGAGGTGCTGGGGG - Intergenic
1108064359 13:46562582-46562604 GTCACATTCTGAGGTGCTAGGGG + Intronic
1112097620 13:96151989-96152011 GTTACATTCTGAGATACTAGGGG + Intronic
1112288124 13:98122054-98122076 GTTTCATTCTGAGAGGCTGGGGG - Intergenic
1112601374 13:100858830-100858852 GTCACATTCTGAGGTACTAGGGG - Intergenic
1112694927 13:101937304-101937326 GTCACATTCTGAGGTACTAGGGG - Intronic
1113070060 13:106411579-106411601 GTTACATTCTGAGACACTAGAGG + Intergenic
1114514761 14:23291410-23291432 GTTACATTCTGAAGTACTAGGGG - Intronic
1114744083 14:25128004-25128026 GTCACATTCTGAGATACTGGAGG - Intergenic
1114874314 14:26696785-26696807 GTCACATTTTGAGATACTGAAGG + Intergenic
1115706824 14:36007770-36007792 GCCACATTCTGAGATGCTGGGGG + Intergenic
1116029882 14:39558188-39558210 GTTACATTCTGAGGTACTGGGGG + Intergenic
1116030249 14:39562502-39562524 GTTACATTCTGAGGTACTAGAGG - Intergenic
1116070805 14:40042862-40042884 GTTACATTCAGAGGTGCTGGGGG - Intergenic
1116427109 14:44804884-44804906 GTTGCATTCTGAGATACTGGAGG - Intergenic
1116675304 14:47898924-47898946 GTCACATTTTGAGGTGCTGAGGG + Intergenic
1116987043 14:51231634-51231656 GTTACACTATGAGTTACTAGAGG + Intergenic
1116997636 14:51340339-51340361 TTTACATTCTGAGATCCTGGGGG + Intergenic
1117052758 14:51878287-51878309 GTTACATTTTAAAATGGTGGGGG - Intronic
1117855481 14:60026972-60026994 GTCACATTTTGAGGTACTGGAGG + Intronic
1117912868 14:60651114-60651136 TTTGCATATTGAGATGCAAGTGG + Intronic
1117984388 14:61373480-61373502 GTTACAATTTGAGATGAGTGGGG + Intronic
1119105035 14:71915757-71915779 GTCACATTCTGAGGTACTAGGGG - Intergenic
1119129714 14:72160542-72160564 GTCACATTCTGAGATACTGGGGG - Intronic
1119390969 14:74290642-74290664 GTTACATTCTGAGTCACTAGGGG - Intronic
1120157527 14:81110235-81110257 GTCACATACTAAGATGCTAGAGG - Intronic
1120528805 14:85608119-85608141 GTCACATTCTGAGATACTGGGGG + Intronic
1120678796 14:87453988-87454010 GTTTCATTCTGCGATGCTAGGGG + Intergenic
1121148765 14:91610767-91610789 GCCACATTTTGAGATACTGGAGG - Intronic
1121542212 14:94736906-94736928 GTCACATTCTGAGATTCTGGGGG - Intergenic
1121722601 14:96121002-96121024 GACACATTTTGAGGTACTAGGGG - Intergenic
1121900621 14:97690370-97690392 GTCACATTTTGAGGTACTAGGGG + Intergenic
1122022498 14:98850799-98850821 GTCACATTTTGAGATACTAGGGG - Intergenic
1125783163 15:42289776-42289798 GTCACATTCTGAGGTACTAGAGG - Intronic
1126010268 15:44295826-44295848 GTTACATTCTGAGATCCTGGAGG + Intronic
1126200587 15:45981298-45981320 GTTACATCTAGAGATCCTTGAGG + Intergenic
1126931860 15:53662294-53662316 ATTCCAATTTGAAATGCTAGAGG - Intronic
1128706675 15:69841948-69841970 GTTACATTCTGAGGAACTAGGGG - Intergenic
1129555748 15:76507096-76507118 GTTATATTCTGAAATACTAGGGG - Intronic
1129649433 15:77471862-77471884 GTTGCTTTTTGAAATGCTATTGG + Intronic
1130097841 15:80869262-80869284 GTCACATTCTGAGGTGCTGGGGG + Intronic
1130302398 15:82689688-82689710 GTTACATTCTGAGGTACTAGGGG - Intronic
1130328700 15:82903002-82903024 TTTACATTTTGAAACACTAGTGG - Intronic
1131366675 15:91847372-91847394 GTCACATTCTGAGGTGGTAGGGG + Intergenic
1132138332 15:99366785-99366807 GTCACATTATGAGGTACTAGAGG + Intronic
1132208936 15:100006132-100006154 GTCACATTCTGAGATACTGGGGG + Intronic
1132436454 15:101808308-101808330 GTTAGTTTTTCCGATGCTAGAGG - Intronic
1133042951 16:3070228-3070250 ATTACAGTTTGAGATGATTGGGG + Intronic
1133573372 16:7064053-7064075 GTCACATTCTGAGTTACTAGAGG - Intronic
1133922112 16:10162704-10162726 GTCACATTCAGAGATACTAGGGG + Intronic
1134350147 16:13429910-13429932 GTCACATTCTGAGATACTAAGGG - Intergenic
1134506508 16:14811933-14811955 GTGATATTCTGAGGTGCTAGGGG + Intronic
1134574045 16:15316832-15316854 GTGACAGTCTGAGGTGCTAGGGG - Intergenic
1134859749 16:17550655-17550677 GTCACATTTTGAAGTACTAGGGG + Intergenic
1134904201 16:17965534-17965556 TTTACATTTTCAGATGATTGAGG + Intergenic
1135872253 16:26161814-26161836 GTCACATTTTGAGGTGCTGGGGG - Intergenic
1135946505 16:26869592-26869614 GTCACATTCTGAGGTACTAGGGG + Intergenic
1136092946 16:27933757-27933779 TTTGCATTTTGAGAAGATAGTGG - Intronic
1137801625 16:51266909-51266931 GTCACATTCTGAGATACTGGGGG - Intergenic
1138060555 16:53885575-53885597 GTAAGATTGTGAGATGCTTGAGG + Intronic
1138145939 16:54611960-54611982 GTCACATTCTGAGGTACTAGGGG - Intergenic
1138173118 16:54871551-54871573 GTCACATTTTTAGGTGCTGGGGG - Intergenic
1138721601 16:59088721-59088743 GTTACATTCTGAGATACTATGGG - Intergenic
1138751786 16:59431012-59431034 GTTACATTCTGAGGGGCTGGAGG + Intergenic
1138799928 16:60014934-60014956 GTTACATTTTGTAATGATAAAGG + Intergenic
1138965285 16:62077242-62077264 GTTACATTCTGAGGTGCAGGGGG - Intergenic
1139739688 16:69024567-69024589 GGTACAATTTAAGAGGCTAGAGG - Intronic
1140968545 16:79990843-79990865 ATTACATTTTGAGGTACCAGGGG + Intergenic
1143345723 17:6247450-6247472 GTCACATTCTGAGGTACTAGTGG + Intergenic
1143717479 17:8785347-8785369 GTAACATGTTGATATGATAGTGG + Intergenic
1143901146 17:10175844-10175866 GTCACATTCTGAGGTACTAGGGG + Intronic
1144109497 17:12018552-12018574 GTCCCATTCTGAGATGCTGGGGG + Intergenic
1144154985 17:12491616-12491638 GTCACATTCTGAGATACTGGGGG - Intergenic
1145101737 17:20082774-20082796 GTTACATTCTGAGACATTAGGGG + Intronic
1146315058 17:31800322-31800344 GTGACATTTTGAGGTTCTGGGGG + Intergenic
1147952725 17:44115978-44116000 GTTACCTTTCCAGATGCTGGCGG - Intronic
1148889791 17:50799460-50799482 GTCACATTCTGAGATACTAGGGG + Intergenic
1149036509 17:52140536-52140558 GTTACATTTTCAGATAGTTGGGG - Intronic
1149203095 17:54210965-54210987 GTAACATTTAGAGATGCTTTTGG + Intergenic
1149450426 17:56745811-56745833 GTTACATTTTGAAGTACTCGAGG - Intergenic
1149549402 17:57528820-57528842 GTCACATTTTGAGGTCCTGGGGG + Intronic
1150459984 17:65342378-65342400 GTCACATTCTGAGATACTGGAGG + Intergenic
1150469174 17:65421815-65421837 GTCACATTCTGAGGTACTAGGGG - Intergenic
1151138894 17:71973012-71973034 GTTACATTCTGAGGTGTTAGGGG + Intergenic
1151331532 17:73412511-73412533 GTCACATTCTGGGGTGCTAGGGG - Intronic
1154056578 18:11018341-11018363 GTCACATTCTGAGATCCTGGGGG + Intronic
1155128179 18:22901469-22901491 GTTACATTCTGAGGTACTAAGGG - Intronic
1155337958 18:24784596-24784618 GTTACATTCTGAGGTACTGGGGG + Intergenic
1155514657 18:26612366-26612388 GTTACATTCTGAGGTACTGGGGG - Intronic
1155623703 18:27810548-27810570 ATTATATTCTGAGAAGCTAGGGG - Intergenic
1155760125 18:29554740-29554762 GTTACATTCTGAGATACTGGAGG - Intergenic
1155929112 18:31686645-31686667 GTAACATTTTTAGATGCTTAAGG + Intergenic
1156235268 18:35197260-35197282 GTACCATTTTGAGAAGCCAGGGG - Intergenic
1158322343 18:56277445-56277467 GTCACATTCTGAGATTCTAGGGG - Intergenic
1158347860 18:56533902-56533924 GTCACATTATGAGATACTGGGGG + Intergenic
1158889527 18:61859915-61859937 GCTACATTCTGAGATACTAGGGG - Intronic
1159438231 18:68445540-68445562 GTTACATTCTGAGGTACTGGGGG - Intergenic
1159674265 18:71262044-71262066 GTCACATTCTGAGGTTCTAGGGG - Intergenic
1160044961 18:75378273-75378295 GTTAAACTTTGAGATTCTTGCGG + Intergenic
1161629937 19:5348799-5348821 GTCACATTCTGAGGTCCTAGGGG + Intergenic
1162749127 19:12817618-12817640 GTCACGTTTTGACATGCTGGGGG + Intronic
1164781304 19:30895807-30895829 GTGACATTCTGAGATACTGGGGG + Intergenic
1165282708 19:34810851-34810873 GTCACATTCTGAGGTGCTGGGGG + Intergenic
1167265731 19:48482306-48482328 ATCACATTCTGAGATGCTGGGGG - Intronic
1167591173 19:50405311-50405333 GTTACATTCTGAGGTGCCGGGGG + Intronic
1167735334 19:51291141-51291163 GTTACATTCTGAGCTACTGGGGG + Intergenic
1168570791 19:57467359-57467381 ATCACATTTTGAGGTACTAGGGG - Intronic
925119226 2:1404438-1404460 GGTACATTCTGAAATGCTGGGGG - Intronic
925478820 2:4247835-4247857 GTCACATTCTGAGGTGCTGGGGG - Intergenic
925519995 2:4733512-4733534 CTTCCATTTTGGGAAGCTAGAGG + Intergenic
925744482 2:7032777-7032799 GTCACATTCTGAGATACTAGGGG + Intronic
926016451 2:9456622-9456644 GTTATATGTTAAGATGCTAGTGG + Intronic
926126044 2:10272454-10272476 GTCACATTTTGAGGTACTGGGGG - Intergenic
926258048 2:11227254-11227276 TTTCCTTTATGAGATGCTAGTGG - Exonic
927066382 2:19475338-19475360 GTCACATTCTGAGGTACTAGGGG - Intergenic
927198443 2:20563907-20563929 GTTAGAGTTTGAGAAGCTCGGGG + Intronic
927359829 2:22220173-22220195 GTCACATTCTGAGATTCAAGTGG - Intergenic
927454919 2:23241129-23241151 GTCACATTCTGAGGTGCTGGGGG + Intergenic
927626467 2:24725541-24725563 GTCACATTCTGAGATACCAGGGG + Intronic
927816496 2:26222042-26222064 GTCACATTCTGAGATACTGGAGG - Intronic
927876731 2:26661657-26661679 GTTATATTATGAAATGCTGGGGG - Intergenic
928066084 2:28165915-28165937 GTTATATTCTGAGGTACTAGGGG - Intronic
930424639 2:51197150-51197172 GTTACATTCTGATATACTAGGGG - Intergenic
930535709 2:52643656-52643678 GTCACATTTTGAGGTATTAGTGG + Intergenic
931143968 2:59496094-59496116 TTCACATTTTGAGATGCTGCTGG + Intergenic
931163425 2:59719013-59719035 GTCACATTCTGAGGTACTAGGGG + Intergenic
931259403 2:60604203-60604225 GTAACATTCTGAGGTACTAGGGG - Intergenic
931986846 2:67750506-67750528 GTCACATTCTGAGATACTGGGGG + Intergenic
932055228 2:68436808-68436830 CTTACAGTTTGAGATTCTGGAGG + Intergenic
932196053 2:69784994-69785016 GTCACATTCTGAGGTGCTGGAGG + Intronic
933851831 2:86373445-86373467 CTTGCATTTTGAGAAGCCAGTGG + Intergenic
933942511 2:87256257-87256279 GTCACATTCTGAGGTACTAGGGG - Intergenic
933972099 2:87478352-87478374 GTCACATTCTGGGGTGCTAGAGG + Intergenic
935293133 2:101626478-101626500 GTCACATTCTGAGGTACTAGGGG + Intergenic
935331703 2:101982060-101982082 GTCACATTCTGAGATACTGGGGG + Intergenic
935454954 2:103256678-103256700 GTCACATTTTCAGATTCTGGAGG + Intergenic
935529869 2:104219120-104219142 GTCACATTCTGAGATACTGGGGG + Intergenic
935566380 2:104612378-104612400 ATTACATTCTGAGGTACTAGGGG + Intergenic
936321629 2:111471845-111471867 GTCACATTCTGGGGTGCTAGAGG - Intergenic
936337714 2:111605311-111605333 GTCACATTCTGAGGTACTAGGGG + Intergenic
936602804 2:113915471-113915493 GTTACATTCTGAGGTACTGGCGG + Intronic
936818484 2:116489238-116489260 GTCACATTATGAGGTGCTGGGGG - Intergenic
937122118 2:119447949-119447971 GTCACATTCTGAGATACTGGGGG - Intronic
937331686 2:121034532-121034554 GTCACATTCTGAGGTGCCAGTGG + Intergenic
938195330 2:129322105-129322127 GTTACATTCTGAGATAGTAGGGG + Intergenic
938638364 2:133253173-133253195 GTTACATTTTGAAATGCATTGGG - Intronic
938982196 2:136537513-136537535 GTTATATTTTGAGGTACTGGGGG - Intergenic
939174176 2:138730397-138730419 GTCACATTTTGAGGTCCTGGAGG + Intronic
939567635 2:143803322-143803344 GTCACATTCTGAGGTACTAGGGG + Intergenic
939725901 2:145721298-145721320 GTTACATTTGGTGATGTTGGTGG - Intergenic
940157621 2:150675955-150675977 GTCACATTCTGAGATACTGGGGG - Intergenic
940459017 2:153938856-153938878 GTTCCATTCTAAGATACTAGGGG + Intronic
941007340 2:160261530-160261552 GTTACATTATGAAGTACTAGGGG + Intronic
941344633 2:164352357-164352379 GTCACATTGTGAGGTGCTGGGGG + Intergenic
942189315 2:173455302-173455324 GTTACATTTTGAGGTACTACAGG + Intergenic
942245883 2:174007813-174007835 GTCACATTCTGAGGTACTAGGGG + Intergenic
942893488 2:181020437-181020459 CTCACATTTTGAGATACTGGGGG + Intronic
943448100 2:188015101-188015123 ATTACATTCTGAGGTACTAGGGG + Intergenic
943542903 2:189239873-189239895 GTTCCTTCTGGAGATGCTAGGGG - Intergenic
943550543 2:189333570-189333592 GTTACATTTTGAGGTACTGGGGG - Intergenic
943665108 2:190601046-190601068 GTCACATTTTGAGGTACTAGGGG - Intergenic
944152813 2:196579639-196579661 GTTACATTTTGAACTACTTGGGG - Intronic
944832442 2:203546354-203546376 GTCACATTCTGAGGTACTAGGGG + Intergenic
944982108 2:205133255-205133277 GTTATAATTTGAAATGTTAGCGG + Intronic
945124192 2:206490000-206490022 GTTACATTCTTAGGTACTAGGGG - Intronic
945549709 2:211205616-211205638 GTCACATTCTGAGATACTAAGGG + Intergenic
945815363 2:214599204-214599226 GTCCCATTTTGAGGTGCTAGGGG + Intergenic
946293121 2:218760971-218760993 GTCACATTCTGAGGTGCTGGGGG + Intergenic
946528386 2:220544306-220544328 GTCACATTTTGACATACTGGAGG + Intergenic
946769712 2:223076368-223076390 GTCACATTCTGAGATACTGGAGG - Intronic
946872241 2:224094653-224094675 GTTACATCTTGAGGTTCTAGGGG - Intergenic
947001206 2:225458725-225458747 TTTAAATTTTGAGCTGCTAAAGG - Intronic
947059313 2:226144746-226144768 GTTACATTGTGAGATCTTTGGGG - Intergenic
948095659 2:235332236-235332258 GTCACATTTTGAGGTACTGGGGG - Intergenic
948261254 2:236606040-236606062 GCGACATTCTGAGATACTAGGGG + Intergenic
948318359 2:237047880-237047902 GTTACATTCTGAGGTACTAGGGG - Intergenic
948361328 2:237422563-237422585 GTCACATTCTGAGGTACTAGAGG + Intronic
1170067981 20:12335140-12335162 GGAACATTTTGAGATGAAAGTGG + Intergenic
1170296664 20:14833724-14833746 ATTACATTTTGAAATGCTAGTGG + Intronic
1170388988 20:15851610-15851632 GTCACATTCTGAGATACTGGGGG + Intronic
1170451711 20:16490135-16490157 GTCACATTCTGAGGTACTAGGGG - Intronic
1171009708 20:21502406-21502428 GTCACATTTTAAGATACTGGGGG + Intergenic
1172283637 20:33725719-33725741 GTTACATTCTGAGGTACTAGGGG + Intergenic
1172866002 20:38097887-38097909 GTCACATTTACAGATGCTGGGGG + Intronic
1173042303 20:39475769-39475791 GTTACCTTGTGAGATACTAGGGG + Intergenic
1173956776 20:47039259-47039281 TTTACATTTTCAGATGGTTGAGG + Intronic
1174052107 20:47774129-47774151 GCTACATTTGGAGATGCGAGTGG + Intronic
1175699131 20:61124461-61124483 GTCACATTCTGAGATGCTGGAGG + Intergenic
1176901544 21:14448240-14448262 GTTATATTCTGAGGTGCAAGAGG + Intergenic
1176910723 21:14561640-14561662 GTCACATTCTGAGGTGCTGGGGG - Intronic
1177010490 21:15726043-15726065 GTTACATTCTGAAGTGCTAGGGG - Intergenic
1177116232 21:17090381-17090403 GTTACATTCTGAGGTACTGGGGG + Intergenic
1177473549 21:21589860-21589882 GTCAAATTCTGAGATACTAGTGG - Intergenic
1177859190 21:26433300-26433322 GTTACATTCTGAGGTACTGGGGG - Intergenic
1177877522 21:26651919-26651941 GTTACATTCTGAGGTCCTAGAGG - Intergenic
1178402187 21:32296266-32296288 GTCACATTCTGAGATACTGGGGG + Intronic
1178419698 21:32433754-32433776 GCCACATTTTGAGGTGCTGGGGG - Intronic
1178721984 21:35018351-35018373 TTCACCTTTTGAGATACTAGGGG - Intronic
1179095679 21:38312513-38312535 GTCACATTCTGAGGTACTAGGGG + Intergenic
1179193504 21:39143398-39143420 GTTACAGTTTGAGCTACTAGGGG + Intergenic
1179251605 21:39675368-39675390 GTCACATTCTGAGGTGCTGGGGG + Intergenic
1180036480 21:45252880-45252902 GTCACATTCTGAGGTTCTAGGGG - Intergenic
1182235581 22:28873634-28873656 CTTACAGTTTGAGATGCGAGAGG + Intergenic
1182240918 22:28915415-28915437 GTCACATTTTGAGGTACTGGGGG + Intronic
1182510271 22:30814756-30814778 GTCACATTCTGAGATCCTGGGGG + Intronic
1182814653 22:33150115-33150137 GATACTTTTTGAGAGGCTTGGGG - Intergenic
1182901558 22:33902791-33902813 GTCACATTTTGAGGTTCTGGGGG - Intronic
1183908479 22:41060985-41061007 GTTACATTCTGAGGTACTAGGGG + Intergenic
949165475 3:935481-935503 GGTTGATTTTGAGATCCTAGTGG + Intergenic
949367099 3:3294126-3294148 TTAACATTTTGACATGCTACTGG - Intergenic
951927813 3:27927989-27928011 GTTTCATTTTGAGATTTTGGAGG - Intergenic
951950583 3:28196102-28196124 TTCACATTTTTAGTTGCTAGTGG - Intergenic
951954295 3:28237849-28237871 GTCACATTCTGAGGTGCTGGGGG - Intergenic
952308059 3:32162677-32162699 GTCACATTCTGAGATACTAGGGG + Intronic
952872748 3:37916397-37916419 GTAACATTTTGAAGTACTAGGGG - Intronic
953317226 3:41940124-41940146 GATACTTTTTGAGAGGCTTGGGG - Intronic
953382965 3:42487986-42488008 GCTACATTTTGAGGTACTAGGGG - Intergenic
955047786 3:55376255-55376277 GGTACATTTTGAGTAGCAAGAGG - Intergenic
955168229 3:56536330-56536352 GTCACATTCTGAGATACTGGAGG + Intergenic
955849505 3:63204506-63204528 GTCACATTTTGAGGTACTGGGGG + Intergenic
955971147 3:64439816-64439838 GTTACATTTTTAGATGGTTGGGG - Intronic
955999437 3:64713160-64713182 ATTACATTCTGAGGTTCTAGGGG - Intergenic
956722983 3:72134544-72134566 GTCACATTCTGAGATACTGGAGG - Intergenic
956752344 3:72353331-72353353 GTTGCATTCTGAGATACCAGGGG - Intergenic
957163312 3:76637666-76637688 GTGAGCTTTTGAAATGCTAGAGG + Intronic
958270038 3:91488250-91488272 GTCACATTTGGAGCTACTAGAGG - Intergenic
958921426 3:100110244-100110266 GCTTCATTTAGAGATGTTAGGGG + Intronic
959021642 3:101193866-101193888 GTTACTTTTTGAAAAGCTACAGG + Intergenic
959147385 3:102565372-102565394 ATCACATTGTGAGATACTAGGGG + Intergenic
959513979 3:107245009-107245031 GTTACCTTATGAGGTACTAGGGG + Intergenic
959548956 3:107632023-107632045 GTTTCAATTTCAGATCCTAGTGG + Intronic
959731912 3:109613731-109613753 GTCACATTCTGAGGTACTAGGGG - Intergenic
960151117 3:114249864-114249886 GTCACATTCTGAAGTGCTAGGGG - Intergenic
960255725 3:115509223-115509245 CTTTCATTTTAAGTTGCTAGTGG + Intergenic
960742810 3:120853449-120853471 GTCACATTCTGAGGTACTAGGGG - Intergenic
961100221 3:124192119-124192141 GTTACATTTTGAGGTACTGGGGG - Intronic
961328361 3:126124830-126124852 GATACATGTTGAAATGCTTGAGG + Intronic
961583421 3:127902291-127902313 GTTACATTCTGAGGTACCAGGGG + Intergenic
961884262 3:130085637-130085659 GTCACATTTTGAGGTACTGGGGG + Intronic
962032965 3:131620779-131620801 GTTACTTTTCCAGCTGCTAGAGG - Intronic
962560698 3:136603405-136603427 TTAACATTTTAAAATGCTAGAGG - Intronic
963654186 3:148024526-148024548 GTTATATTCTGAGCTACTAGGGG - Intergenic
965107026 3:164369404-164369426 ATTATATTTTCAAATGCTAGTGG - Intergenic
965135623 3:164763619-164763641 GATACATTTTGAGAGGCCTGAGG - Intergenic
965751438 3:171978761-171978783 ATTACATTCTGAGATACTAAGGG + Intergenic
965806573 3:172548345-172548367 GTCACATTCTGAGATACTGGGGG - Intergenic
965988639 3:174788641-174788663 GTAACATTCTGAGATACTAGGGG + Intronic
966080445 3:175993748-175993770 CATACATTTTGAGAGGCAAGGGG + Intergenic
966303927 3:178509571-178509593 GTCATATTCTGAGATACTAGGGG - Intronic
966403206 3:179567421-179567443 GTCACATTCTGAGGTACTAGGGG + Intronic
966443174 3:179970020-179970042 GTTATATTTTGAGATCCTTGTGG - Intronic
966733181 3:183167656-183167678 GTCACATTCTGAGATACTTGGGG + Intergenic
967117009 3:186351054-186351076 TTTACCTTTGGAGATGTTAGTGG + Intronic
967301779 3:188021361-188021383 GTTACATTCTGAGGTCCTGGGGG - Intergenic
967616382 3:191573198-191573220 GTCATATTTTGAGATACTGGGGG - Intergenic
967708157 3:192676593-192676615 GTTACATTTTGAGTTACTGTAGG - Intronic
968607941 4:1544400-1544422 GTCACATTCTGAGGTGCTGGGGG - Intergenic
969044334 4:4325833-4325855 CAGACATTTTGAGATGCTGGGGG - Intergenic
969322733 4:6422780-6422802 GTCACATTCTGAGGTGCTGGGGG + Intronic
969328694 4:6460185-6460207 GTCACATTTTGAGGTTCTAGGGG - Intronic
969459039 4:7317936-7317958 GTCACATTCTGAAGTGCTAGGGG - Intronic
969856115 4:10001201-10001223 GTCACATTCTGAGGTACTAGGGG - Intronic
969931914 4:10638987-10639009 GTCACATTCTGCGATGCTGGGGG + Intronic
970053157 4:11939233-11939255 GTTACATTCTGTGATACTGGGGG - Intergenic
970138375 4:12951429-12951451 GCTACATTCTGAGGTACTAGGGG + Intergenic
970467088 4:16335239-16335261 CTTACGTTTAGAGGTGCTAGGGG - Intergenic
970748941 4:19334320-19334342 CTCACATTCTGAGATACTAGCGG - Intergenic
970820108 4:20202139-20202161 CTTACATTTGTAGATGGTAGGGG - Intergenic
970897545 4:21120900-21120922 GTCACATTTTGAGGCACTAGGGG + Intronic
971333620 4:25702810-25702832 ATTACATCCTGAGATACTAGGGG + Intergenic
971841129 4:31853696-31853718 GTCACATTCTGAAATACTAGGGG - Intergenic
972167696 4:36307520-36307542 GTCACATTCTGAGGTACTAGGGG + Intronic
972359741 4:38315884-38315906 GTCACATTCTGAGATGCTGGGGG - Intergenic
972598009 4:40547247-40547269 GTCACATTGTGAGATACTAGGGG - Intronic
972812292 4:42603665-42603687 GGCAGATTTTGAGATGCTAAAGG - Intronic
972994807 4:44867220-44867242 ATTACATTTTGAGGTGCTGCTGG + Intergenic
973971523 4:56218172-56218194 GTTACATTCTGAGATAGTAGGGG + Intronic
974228314 4:59078017-59078039 GTCACATTGTGAGGTACTAGAGG + Intergenic
974383295 4:61170856-61170878 TTTAGATTTTGTGATGCTTGTGG + Intergenic
974516436 4:62919496-62919518 ATGACATTTTGAGATGATCGAGG + Intergenic
976205715 4:82621520-82621542 GTCACATTCTGAGGTACTAGAGG + Intergenic
976323707 4:83747373-83747395 GTCACATTTTGAGATGCTGGGGG - Intergenic
976695990 4:87920213-87920235 GTCACATTTTGAGATACTTGGGG + Intergenic
976699311 4:87951960-87951982 GTCACATTATGAGATTCTGGAGG - Intergenic
976832509 4:89331166-89331188 GTCACATTTTGAGATCCTGGGGG + Intergenic
976999645 4:91481517-91481539 GTCACATTCTGACATGCTGGTGG + Intronic
977683482 4:99820876-99820898 TGTACATTTTGAAATGCTTGAGG - Intronic
977907563 4:102496294-102496316 GTTACATTCTGAGGTACTGGGGG - Intergenic
977927218 4:102714960-102714982 ATTACATTCTGAGATACCAGAGG + Intronic
978165946 4:105607021-105607043 GTTACTTTTAGAGATGTTAGTGG + Intronic
978344670 4:107754640-107754662 GTCACATTTTGAGGTACTGGAGG + Intergenic
978524534 4:109652213-109652235 GTCACATTCTGAGGTACTAGGGG + Intronic
978912268 4:114078130-114078152 GTTACATCCTGAGGTACTAGGGG - Intergenic
978991909 4:115094621-115094643 GTCACATTCTGAGATACTGGGGG - Intronic
979399060 4:120225377-120225399 GTCACATTTTGAGCTACTAGGGG + Intergenic
980005305 4:127535302-127535324 GTCACATTTTGAAGTACTAGGGG + Intergenic
980529034 4:134026653-134026675 GATACATTCTGAGATGTTTGGGG - Intergenic
981569007 4:146131975-146131997 GTCACATTCTGAGATACTGGAGG - Intergenic
981605425 4:146535475-146535497 GTCACATTTTGAGGTACTAGGGG - Intergenic
981682508 4:147415879-147415901 GTTACATTTTGAAGTACTGGGGG - Intergenic
982932446 4:161426272-161426294 TTTAGATATTGAGATTCTAGAGG - Intronic
983089147 4:163483849-163483871 GTCACATTCTAAGATACTAGTGG + Intergenic
983278607 4:165651627-165651649 CTTACAATTTCATATGCTAGGGG + Intergenic
983541866 4:168919810-168919832 GTTACATTGTGACCTGCTGGTGG + Intronic
983689275 4:170448449-170448471 GTCACATTCTGAGGTGCTAGGGG + Intergenic
983721482 4:170858033-170858055 ATTACATTTTAAAATGATAGTGG + Intergenic
984271259 4:177551204-177551226 GTCACATTCTGAGATACTGGGGG - Intergenic
984962750 4:185113455-185113477 GTTACATTCTGAGGTGCTGGGGG - Intergenic
985396349 4:189548729-189548751 GTTCTATTTTTAGATACTAGGGG + Intergenic
985829524 5:2217892-2217914 GTCACATTCTGAGGTGCTAGGGG + Intergenic
986406243 5:7427698-7427720 GTCACATTCTGAGGTTCTAGGGG + Intronic
986643476 5:9893994-9894016 GTTACATTCTGAGGTACTGGGGG - Intergenic
986661594 5:10064837-10064859 GTCACATTCTGAGGTGCTAGGGG - Intergenic
987120298 5:14760907-14760929 GTCACATCCTGAGATGCCAGGGG - Intronic
987362868 5:17122420-17122442 GTCACATTTTGAGGTACTGGGGG - Intronic
987780893 5:22433822-22433844 GTAACATTTTGAAATGCAAATGG + Intronic
987897743 5:23969967-23969989 GTTATATTCTGAGATACTAGGGG + Intronic
988075269 5:26344221-26344243 GTCACATTCTGAGATACTGGGGG + Intergenic
988360676 5:30232752-30232774 GTCACAGTCTGAGATACTAGGGG - Intergenic
988399421 5:30742434-30742456 GTTACATTTTGAGATATTGGGGG + Intergenic
988862455 5:35297730-35297752 GTTACATTCTGAGGTCCTGGAGG + Intergenic
989708742 5:44370855-44370877 GAAACATTTTGAGATGTGAGAGG + Intronic
990076761 5:51855236-51855258 GTTACATTCTGAGATACTAAGGG - Intergenic
990323632 5:54653169-54653191 ATTACATTTTGAGACACTGGGGG - Intergenic
990451936 5:55942008-55942030 GTTACATTTTGATAAGCTAATGG + Intronic
990785287 5:59411734-59411756 GTTACATTCTGAGGTACCAGGGG + Intronic
991000807 5:61781047-61781069 GTCACATTCTGAGGTGTTAGGGG - Intergenic
991016618 5:61940098-61940120 ATTACCTTTTGAGATGCCATAGG - Intergenic
991400502 5:66246198-66246220 GTTACACATTGAGGTACTAGGGG + Intergenic
991553704 5:67871826-67871848 GTTCCATTGTGAGTTGCTTGAGG + Intergenic
992518158 5:77518231-77518253 ATTACATTATGAGATGCAATAGG - Intronic
993094549 5:83466085-83466107 GTTACCTTGTGAGATGATATGGG + Intergenic
993633147 5:90312052-90312074 GTTTCATCTTGAGCTGCTAATGG - Intergenic
994376684 5:99022749-99022771 GTAACATTTTGAGAATCTTGAGG - Intergenic
994423021 5:99546114-99546136 GTTAGATTTTGATATGCTGCTGG + Intergenic
994520710 5:100830986-100831008 GTTTTATTTTGAGAAGCTATAGG - Intronic
994697125 5:103086330-103086352 GTCACATTTTGAGGTGGTGGGGG + Exonic
996240254 5:121190285-121190307 GTCACATTTTAAGGTACTAGGGG + Intergenic
996263800 5:121509190-121509212 GTCACATTTTAAGATACTAGGGG + Intergenic
996422179 5:123274787-123274809 GTCACATTCTGAGGTTCTAGGGG - Intergenic
996534954 5:124568163-124568185 GCTACATTTTGAGGTACTGGGGG - Intergenic
998360391 5:141581004-141581026 GTTACATTTTGAGGTACTGGGGG - Intronic
999067827 5:148710315-148710337 GTTACATTCTGAGGTACTAGGGG + Intergenic
999076659 5:148802737-148802759 GTCACATTCTGAGGTACTAGGGG + Intergenic
999081607 5:148849409-148849431 GTCACATTGTGAGATACTAGGGG + Intergenic
999507839 5:152216817-152216839 GTTTAATTTTGAGATGCCACTGG - Intergenic
1000682576 5:164204316-164204338 GTCACATTCTGAGATACTTGAGG - Intergenic
1001056210 5:168452314-168452336 GTCACATTCTGAGGTACTAGGGG - Intronic
1001338845 5:170825286-170825308 GTTACATTCTGAGGTCCTGGGGG + Intergenic
1001707196 5:173750104-173750126 GTCACATTTTGAGGTACTAGGGG - Intergenic
1001773699 5:174313427-174313449 GTCACATTCTGAGGTACTAGGGG + Intergenic
1001801148 5:174545302-174545324 GCCACATTTTGAGATACTAGGGG - Intergenic
1002700207 5:181118772-181118794 GTCACATTTTGAGGTCCTAGTGG + Intergenic
1002799704 6:510623-510645 TTTACATTTTGAAATGAGAGGGG - Intronic
1003095943 6:3143738-3143760 GTCACACTCTGAGATGCTGGGGG + Intronic
1003311265 6:4971789-4971811 GTCACATTCTGAGACGCTAGAGG + Intergenic
1003399666 6:5781478-5781500 GTCACACTCTGAGGTGCTAGGGG - Intergenic
1003598271 6:7494388-7494410 GTCACATTCTGAGATACTAGGGG - Intergenic
1004233825 6:13855629-13855651 GTCATATTTTGAGGTACTAGGGG + Intergenic
1004510360 6:16279487-16279509 GTCACATTCTGAGATGCTAGGGG + Intronic
1004729638 6:18345256-18345278 GTCACATTTTGAGGTGCTAGGGG + Intergenic
1005204986 6:23392481-23392503 GTTATTTCTGGAGATGCTAGGGG - Intergenic
1005292582 6:24394182-24394204 GTTACATTCTGAGATACTGGGGG - Intergenic
1005810616 6:29512682-29512704 GTCACATTCTGAGATACTGGGGG - Intergenic
1007509370 6:42363583-42363605 GCCACATTCTGAGATCCTAGGGG - Intronic
1008107114 6:47451072-47451094 GTCACATTCTGAGATTCTAGGGG - Intergenic
1008773923 6:55011405-55011427 GTCACATTCTGAGATACTAGGGG + Intergenic
1008985125 6:57533092-57533114 GTCACATTTGGAGCTACTAGAGG + Intronic
1009173159 6:60426047-60426069 GTCACATTTGGAGCTACTAGAGG + Intergenic
1009322678 6:62311918-62311940 GTCACATTCTGAGGTACTAGTGG - Intergenic
1009422955 6:63483895-63483917 GTCACATTCTGAGGTACTAGGGG + Intergenic
1009467087 6:63985022-63985044 GTCACATTCTGAGGTACTAGGGG - Intronic
1009481499 6:64163838-64163860 GTTAGAGTCTGAGAAGCTAGGGG + Intronic
1009555049 6:65152347-65152369 GTCACATTTTGAGGTACTAGGGG - Intronic
1009612926 6:65970110-65970132 GTTACATTCTGAGGTACTGGGGG - Intergenic
1010049426 6:71485269-71485291 GTTACATTCTGAGATGCTAGAGG + Intergenic
1010866290 6:80980115-80980137 GGTTCATTTTGAGGTGGTAGGGG - Intergenic
1010903455 6:81456154-81456176 GTTATATTTTGATATCATAGTGG + Intergenic
1010950437 6:82030649-82030671 GTCACATTCTGAGGTACTAGGGG + Intergenic
1012380213 6:98611832-98611854 GTCATATTCTGAGGTGCTAGGGG - Intergenic
1012581672 6:100877822-100877844 CTCACATTTTGAGATGCATGTGG - Intronic
1013140562 6:107329634-107329656 GTCACATTGTGAGGTACTAGGGG + Intronic
1013223458 6:108101083-108101105 GTTACATTCTGAGGTACTGGGGG - Intronic
1013719170 6:113001963-113001985 ATTACATGTTGAAATGCTATTGG + Intergenic
1013721697 6:113038344-113038366 GTCACATTCTGAGATACTATGGG - Intergenic
1013786683 6:113789195-113789217 GTCACATTTTAAGGTACTAGGGG + Intergenic
1013989079 6:116232231-116232253 GTCACATTCTGATATACTAGGGG + Intronic
1014349321 6:120319924-120319946 GTCATATTTTGAGATATTAGGGG - Intergenic
1014451874 6:121591473-121591495 GTCACATTCTGAGGTACTAGGGG + Intergenic
1014585209 6:123189727-123189749 GTTACACTCTGAGATACTGGGGG + Intergenic
1014683848 6:124469992-124470014 GTTACAGTTTGAGATGCTCAGGG + Intronic
1014960984 6:127684408-127684430 GTCACATTCTGAGATATTAGGGG + Intergenic
1015015364 6:128406317-128406339 GAAACATTTTGATATGCAAGGGG - Intronic
1015330345 6:131971069-131971091 TCTACATTTATAGATGCTAGTGG + Intergenic
1015589626 6:134810528-134810550 GTCACATTTTGAGATACTGGAGG - Intergenic
1015650002 6:135446207-135446229 GTTACATTCTGAGGTGTTAGGGG - Intronic
1016185995 6:141197837-141197859 GTCACATTCTGAGGTGCTAGAGG + Intergenic
1016348063 6:143137403-143137425 GTCACATTGTGAGATTCTGGGGG + Intronic
1016602337 6:145876732-145876754 GTTACATCCTGAGATACTAGGGG - Intronic
1016697833 6:147018264-147018286 GTCACATTTACAGATACTAGGGG + Intergenic
1017056718 6:150443313-150443335 GTCACATTCTAAGATACTAGGGG - Intergenic
1017136084 6:151148475-151148497 GTTACATTTACAGGTACTAGAGG + Intergenic
1017809073 6:157971131-157971153 GTTACATTTTGAGATCCTGGGGG + Intergenic
1017974982 6:159348955-159348977 GTTACATTATGAGGTACTAGGGG + Intergenic
1018187934 6:161283984-161284006 GTTACCTTTGGAGATGCAGGTGG + Intergenic
1019959433 7:4446667-4446689 TTTACATTTTTAAATGCTTGGGG - Intergenic
1021190111 7:17610496-17610518 GTTACATTATGAGGTACTAGGGG - Intergenic
1021551145 7:21872210-21872232 GTCACATTATGAGATGCTGGGGG + Intronic
1022626384 7:32041018-32041040 CTTACACTTTGAGATGATACAGG - Intronic
1023280637 7:38565634-38565656 GTCACATTCTGAGGTGCTAGGGG + Intronic
1024031085 7:45460303-45460325 GTCACATTCTGAGGTGCCAGGGG + Intergenic
1024286406 7:47761803-47761825 GTTGCATTCTGAGGTACTAGGGG - Intronic
1024904610 7:54362360-54362382 GTCACATTCTGAGGTGTTAGAGG + Intergenic
1026105300 7:67416316-67416338 GTCACATTTTGAGGTACTTGGGG + Intergenic
1026118126 7:67513534-67513556 GTCACATTCTAAGATACTAGAGG - Intergenic
1026507022 7:70993614-70993636 GTCACATTCTGAGGTGCCAGGGG + Intergenic
1027546059 7:79528965-79528987 ATTAGAGTTTGAGATGCTAAAGG - Intergenic
1028430406 7:90740371-90740393 GTTACATTCTGAGGTACTGGGGG - Intronic
1028741247 7:94278263-94278285 GTTTCATTCTGAGATCATAGAGG + Intergenic
1028749897 7:94371659-94371681 GTCACATTCTGAGGTACTAGGGG - Intergenic
1028913943 7:96238037-96238059 GTCACATTCTGAGGTTCTAGGGG - Intronic
1029158747 7:98535970-98535992 GTCACATTCTGAGGTGATAGGGG - Intergenic
1029295451 7:99536783-99536805 GTCACATTCTGAGGTACTAGGGG - Intergenic
1029497998 7:100908101-100908123 TTTACATTTTAAGATGCTTCCGG - Intergenic
1029986524 7:104928034-104928056 GTTACATTCTGAGATAGTGGGGG - Intergenic
1031357690 7:120807651-120807673 GTTAAATTTTGAAATGGTGGGGG - Intronic
1031432373 7:121687941-121687963 GTTACATTCTCAGGTACTAGGGG - Intergenic
1032004388 7:128288610-128288632 GTCACATTCTGAGGTGCTGGGGG - Intergenic
1032265778 7:130368949-130368971 TTTACATTTTAAGATGCTCCTGG + Intergenic
1032527971 7:132594109-132594131 GTTACATTCTGAGATATTGGTGG - Intronic
1032687562 7:134251137-134251159 GTCACATTCTGAGATCCTGGGGG - Intronic
1032877665 7:136054929-136054951 GTTACCTTCTGAGAGACTAGGGG + Intergenic
1032896099 7:136252530-136252552 GTCACATTCTGAGGTACTAGAGG - Intergenic
1033123729 7:138688866-138688888 GTCACATTCTGAGGTACTAGAGG - Intronic
1033212270 7:139468796-139468818 GTCACATTTTGAGGTACTGGGGG - Intronic
1034119732 7:148616541-148616563 GTTGCATTCTGAGGTTCTAGGGG + Intergenic
1034396958 7:150833653-150833675 GTCACATTCTGAGGTACTAGGGG + Intronic
1035046691 7:155972571-155972593 GTTACATTCTCAGGTCCTAGGGG - Intergenic
1035141497 7:156767004-156767026 GTTTCATTTTGAGTGGCTAGTGG - Intronic
1036811954 8:11873146-11873168 GTCACATTCTGAGGTACTAGGGG + Intergenic
1037533794 8:19806296-19806318 GTTACATTCTGAGATACTATGGG + Intergenic
1037649912 8:20826913-20826935 GCTAGATTTTGAGATGCTTATGG + Intergenic
1038120560 8:24609596-24609618 GTCACATTTTGAAGTGCAAGTGG - Intergenic
1038441340 8:27572824-27572846 GTCACATTCTGAGGTGCCAGGGG + Intergenic
1038869435 8:31478473-31478495 GTCACATTCTGAGATACTGGGGG + Intergenic
1039924756 8:41919357-41919379 GTTTCTTTTTGAGATGCTAGTGG + Intergenic
1040869974 8:52090426-52090448 GTCACATTCTGAGGTGCTAGGGG + Intergenic
1041324756 8:56652488-56652510 GTCACATTCACAGATGCTAGGGG - Intergenic
1041435325 8:57832608-57832630 GTCATATTTTGAGTTGCTGGGGG + Intergenic
1043356399 8:79417584-79417606 GTCACATTCTGAGGTACTAGGGG + Intergenic
1043641901 8:82464150-82464172 GAGACATTTTCAGATGCTTGTGG + Intergenic
1043950176 8:86300054-86300076 GTCACATTTTGAGGTACTGGGGG - Intronic
1044827154 8:96209498-96209520 GTCACATTCTGAGATGCTGGGGG + Intergenic
1045224957 8:100235311-100235333 GTTACATTTTGAGGTACTGGAGG + Intronic
1045704095 8:104899986-104900008 GTCACATTTTGAGGTACTGGGGG + Intronic
1045799703 8:106088002-106088024 GTCACATTCTGAGGTTCTAGGGG + Intergenic
1045804291 8:106139057-106139079 GTCACATTCTGAGGTCCTAGGGG + Intergenic
1045850403 8:106689438-106689460 GTCACATTCTGAGATACTGGAGG + Intronic
1045935222 8:107671177-107671199 GTTACTTTTTGAGAGGCCTGGGG + Intergenic
1046213766 8:111115233-111115255 GTCACATTCTGAGATACTTGAGG + Intergenic
1046283102 8:112059434-112059456 GTTAAATTTTGCCATGCTTGTGG + Intergenic
1046704915 8:117439109-117439131 GTCCCATTCTGAGATACTAGGGG - Intergenic
1046852734 8:118993790-118993812 GTCACATTCTGAGATACTGGGGG + Intergenic
1047558154 8:125955956-125955978 GATAGATTTAGAGATGATAGAGG + Intergenic
1047612869 8:126538248-126538270 GTCACATTCTGAAATACTAGGGG - Intergenic
1048049548 8:130804458-130804480 GTTACATTTTGAGATCCTTGGGG + Intronic
1048084990 8:131167664-131167686 GTCACATTCTGAGATACTAAGGG - Intergenic
1048195034 8:132325450-132325472 GTCACATTCTGAGGTCCTAGGGG - Intronic
1048249411 8:132848968-132848990 GTTACAGTTTCAGAGGCCAGTGG - Intergenic
1049068502 8:140338524-140338546 GTCACATTCTGAGGTGCTGGGGG - Intronic
1050753588 9:8971591-8971613 ATTACATGTTTAGATTCTAGTGG + Intronic
1051201131 9:14625679-14625701 GTTACATTTTGAGGTAATTGAGG - Intronic
1051650458 9:19318839-19318861 GTTACATTCCGAGGTACTAGGGG + Intronic
1051778172 9:20658885-20658907 GTCACATTCTGAGGTACTAGGGG - Intronic
1052322947 9:27187942-27187964 GTTACATCCTGAGGTACTAGGGG + Intronic
1054344073 9:63896919-63896941 GTTACAAATTGTGATGGTAGCGG - Intergenic
1054879502 9:70130173-70130195 GTCACATACTGAGATACTAGAGG + Intronic
1055344482 9:75320461-75320483 GTCACATTCATAGATGCTAGGGG + Intergenic
1055573902 9:77644065-77644087 GTTACATTCTGAGGTACTAGTGG - Intronic
1056261793 9:84856126-84856148 GTTACATTTTTAGAGACCAGTGG + Intronic
1056333858 9:85546089-85546111 GTTAGATTTTGTTATGATAGAGG - Intergenic
1056363050 9:85878146-85878168 TTTACATTTTGAAATGATTGGGG + Intergenic
1056598988 9:88031265-88031287 GTCACATTCTGAGACGCTGGTGG + Intergenic
1056906074 9:90648965-90648987 GTCACATTTTGAGTTACTGGGGG - Intergenic
1056958716 9:91103133-91103155 GTCACATTCTGAGATACTGGGGG - Intergenic
1057087986 9:92228252-92228274 GTCACATTTAGAGATACAAGGGG + Intronic
1058388229 9:104463378-104463400 GTTACATTCTGAGGTACTGGGGG - Intergenic
1058503132 9:105642806-105642828 GTCACATTCTGAGATACTAGGGG - Intergenic
1058777880 9:108303050-108303072 GTCACATTCTGAGATCCTGGCGG - Intergenic
1058960955 9:109992368-109992390 GTCATATTTTGAGGTACTAGGGG + Intronic
1059726621 9:117014649-117014671 GTCACATTCTGAGACACTAGAGG - Intronic
1059925578 9:119206006-119206028 GTCACAGTTTGAGATCCTGGGGG - Intronic
1060050959 9:120377783-120377805 GTCACATTCTGAGGTACTAGGGG + Intergenic
1203453270 Un_GL000219v1:140934-140956 GTTGCAAGTTGTGATGCTAGGGG - Intergenic
1185841653 X:3397777-3397799 GTCACATTTTGAGCAACTAGGGG - Intergenic
1186009375 X:5111957-5111979 GTCACATTCTGAGGTCCTAGGGG + Intergenic
1186289149 X:8077778-8077800 CTGACATTTTGAGAGGTTAGGGG + Intergenic
1186442458 X:9597980-9598002 CTCACATTCTGAGATGCAAGGGG - Intronic
1186945613 X:14562832-14562854 GTTACATTTTGAGGTACTGAGGG + Intronic
1187424912 X:19168621-19168643 GTTACATTCTGAGGTACTCGGGG - Intergenic
1187436230 X:19272414-19272436 GTCAAATTCTGACATGCTAGAGG + Intergenic
1189714717 X:43853554-43853576 GTCACATTCTGAGGTCCTAGGGG - Intronic
1190009820 X:46774851-46774873 GTCACATTCTGAGGTACTAGGGG + Intergenic
1190413564 X:50160339-50160361 GTCACATTCTGAGATACTTGGGG + Intergenic
1190622943 X:52306274-52306296 GTCACATTCTGAGGTACTAGGGG + Intergenic
1190792191 X:53710861-53710883 GTCACATTCTGAGGTACTAGGGG - Intergenic
1191846792 X:65552699-65552721 GTCACATTCTGAGGTGCTGGGGG + Intergenic
1191896238 X:65996268-65996290 GTTACATTCTGATGTACTAGGGG + Intergenic
1191929458 X:66353765-66353787 GTTAGATTTTGAAATGCGTGTGG - Intergenic
1192402991 X:70855640-70855662 GTTACATTCTGAGGTGTTGGAGG - Intronic
1193146938 X:78086283-78086305 GTCACATTCTGAGATACTGGGGG - Intronic
1193512100 X:82415266-82415288 GTTAGATTTTGTGATGTTTGAGG - Intergenic
1193999873 X:88414503-88414525 GTCATATTCTGAGATTCTAGGGG + Intergenic
1196466584 X:115978055-115978077 ATTCCATTGTAAGATGCTAGAGG - Intergenic
1196930190 X:120674375-120674397 GTTACACTCTGAGGTACTAGTGG + Intergenic
1197419238 X:126217537-126217559 GTCACATTCTGAGGTACTAGAGG - Intergenic
1197822567 X:130555830-130555852 TTTACATTTAGAGATGTTAAGGG - Intergenic
1198615500 X:138454015-138454037 GTCACATTTTAAAATGCCAGGGG - Intergenic
1198959284 X:142167257-142167279 GTGACATTCTGAGGTACTAGGGG - Intergenic
1198977711 X:142355608-142355630 GTTACATTCTGAGGTACTGGAGG - Intergenic
1199009420 X:142741140-142741162 GACACATTTTGAGGTACTAGAGG + Intergenic
1199660634 X:150046814-150046836 GTTACCATTTGTTATGCTAGAGG - Intergenic
1199697738 X:150355073-150355095 ATCACATTTTGAGATACTGGAGG - Intergenic
1199801929 X:151260217-151260239 GTTACATTCTGAGGTACCAGGGG + Intergenic
1201458337 Y:14195137-14195159 GATACTTTTTGAGAAGCTTGGGG - Intergenic
1201720633 Y:17093145-17093167 GTCACATTCTGAGGTGCTAGGGG + Intergenic