ID: 1081558858

View in Genome Browser
Species Human (GRCh38)
Location 11:44193828-44193850
Sequence TGCCCACTTGCATCCCAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081558858 Original CRISPR TGCCCACTTGCATCCCAAAT AGG (reversed) Intronic
901454952 1:9357898-9357920 AGCCCACTTGCTTCCCAACGTGG - Intronic
903103879 1:21057082-21057104 TGCCAAATTGCTTCCCAAAGTGG - Intronic
908926546 1:69262097-69262119 TCTCCACTTGAATGCCAAATAGG - Intergenic
909154227 1:72050906-72050928 TGCCAATTTGCCTGCCAAATAGG + Intronic
912636049 1:111294509-111294531 TTACCACTTCCTTCCCAAATTGG + Intronic
915031998 1:152887529-152887551 TGCCCACCTGTTTCCCAAAATGG + Intergenic
915135905 1:153731400-153731422 TGCCCATTCCCATCCCAATTTGG + Intronic
915146225 1:153797233-153797255 ACCCCACTTGCAGGCCAAATGGG + Intergenic
917637571 1:176951708-176951730 TGACCACTGCTATCCCAAATTGG + Intronic
1068053776 10:51983977-51983999 TGGCCAATTGCATTTCAAATAGG - Intronic
1071467684 10:85956286-85956308 TGACCACTTGAATCTCTAATTGG + Intronic
1072895819 10:99365761-99365783 TGACCACTTCAATGCCAAATAGG + Intronic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1081558858 11:44193828-44193850 TGCCCACTTGCATCCCAAATAGG - Intronic
1084676620 11:70639204-70639226 AGCCCACTTCCACCCCAAACTGG - Intronic
1091252002 11:134151952-134151974 TGCCCACTGCCATCCCAAGTGGG - Exonic
1098535093 12:71585082-71585104 AACCCACTTGCTTTCCAAATGGG + Exonic
1098562490 12:71890364-71890386 TGACCACTGGCATCCCAATGAGG - Intronic
1100010705 12:89949819-89949841 CTTCCACTTGCATCCCAGATTGG + Intergenic
1100013518 12:89981585-89981607 TGACCACTTGCACCACAAAGAGG - Intergenic
1108166921 13:47702836-47702858 TGCCCACTTGGTTCACAAAGAGG + Intergenic
1114900278 14:27049344-27049366 TTCCCCTTTGCCTCCCAAATAGG + Intergenic
1115029782 14:28781314-28781336 TGTGAACTTGCTTCCCAAATAGG - Intronic
1117738011 14:58787328-58787350 TGACCACTTTCATGCCTAATAGG + Intergenic
1120530343 14:85623388-85623410 AGCCCATTTACACCCCAAATGGG + Exonic
1130851436 15:87798190-87798212 TGCCCACATGCAGCCTAAAAAGG + Intergenic
1131130519 15:89896942-89896964 TGCCAAATTGCTTCCCAAAAGGG - Exonic
1132420415 15:101661194-101661216 TCCCCACTGTCATCCTAAATGGG + Intronic
1132525197 16:410812-410834 TGCCCACGTGGGTCCCCAATGGG + Intronic
1134221206 16:12355732-12355754 TGCCCACATGCAACCCATTTGGG - Intronic
1140929195 16:79611364-79611386 TGTTCACTTGCAACCCAAAGAGG - Intergenic
1143626043 17:8110594-8110616 TGCCCACTTCCACCCCAGAGAGG + Intronic
1143726003 17:8846966-8846988 TGCCTGCTTGAAGCCCAAATTGG + Intronic
1146245021 17:31272795-31272817 TGAACACTTGGATCACAAATAGG + Intronic
1148783466 17:50134195-50134217 TCCCCACTTTAACCCCAAATTGG - Exonic
1149494040 17:57105903-57105925 TGCCCCCTTTCATCCCCAAAGGG + Exonic
1152685457 17:81691586-81691608 GCCCCACCTGCAGCCCAAATGGG - Intronic
1152978722 18:251658-251680 TTCCCTCCTGCATCCCAAAGAGG + Intronic
1157993598 18:52527808-52527830 TGCCCTCGTACATGCCAAATAGG - Intronic
1163846066 19:19638630-19638652 TGCCCACTTGCACTCCAACCTGG - Intronic
1168022523 19:53620009-53620031 TGCCAAATTTCATCCCACATTGG + Intergenic
931180271 2:59892494-59892516 TGCCAAATTGCAACGCAAATAGG + Intergenic
937132330 2:119523198-119523220 TTCCCACTAGCATTCCAAATTGG - Intronic
938314144 2:130314883-130314905 TGCCCACCTGCACCCCCATTGGG + Intergenic
942889756 2:180975146-180975168 TGCCAAATTGCTTCCCAAAAAGG + Intronic
945324266 2:208464495-208464517 TGTCCATGTGCATCTCAAATGGG - Intronic
945427495 2:209724539-209724561 TGGCTACTTGCTTCCCAACTGGG + Intronic
1168838510 20:893847-893869 TGCCCACTGTGATCCCAATTTGG + Intronic
1175587152 20:60150219-60150241 AGCCCACATGGCTCCCAAATAGG + Intergenic
1177694202 21:24551473-24551495 TGCCCCCTCACATCCCTAATGGG - Intergenic
1181361843 22:22343549-22343571 TGCCCACTCGCATCACAAACCGG - Intergenic
1182063021 22:27411175-27411197 TGCCCACTTGGCTCTCCAATGGG - Intergenic
949562103 3:5212699-5212721 TGCACTGTTGCATCCCATATTGG + Intronic
955714931 3:61819521-61819543 TGGCCACTAGCATCACAAATGGG + Intronic
959688337 3:109171789-109171811 TTCCCACTTGTATCCCAGAATGG - Intergenic
963392699 3:144688219-144688241 TGCCCCCTGGGATGCCAAATAGG - Intergenic
964938415 3:162123545-162123567 TGGACATTTCCATCCCAAATGGG + Intergenic
966865291 3:184255477-184255499 TCCCCACTTGCCTCCCTAAGAGG - Intronic
972023412 4:34343941-34343963 TGCACACTTACATCTAAAATAGG + Intergenic
972285389 4:37643098-37643120 TTCCAACTGGCATCCCAAGTAGG + Intronic
975127428 4:70798396-70798418 TGCCCATGTGCATCCAAAAGTGG - Intronic
976228987 4:82820938-82820960 TGCCCCCATGCATACTAAATGGG + Intronic
983233679 4:165155338-165155360 TACCCAAGTGCTTCCCAAATGGG - Intronic
983387945 4:167090192-167090214 TGCCAAATTGCTTCCCAAATTGG + Intronic
989650479 5:43683319-43683341 TGGCCACCTTCATCCCAGATTGG + Intronic
990511859 5:56496745-56496767 TTCCCACTTGCTTCCTGAATAGG + Intergenic
994537346 5:101048701-101048723 TGCCCACCACCAACCCAAATTGG + Intergenic
996758018 5:126955408-126955430 TGCCAACTTGCTTTCCAAAGTGG + Intronic
1000353514 5:160371379-160371401 TGCCTGCTTGATTCCCAAATAGG - Intergenic
1002766591 6:245376-245398 TGGCCAATTGCATCCCAATGGGG - Intergenic
1012825266 6:104139564-104139586 TGCATGCTTGCATTCCAAATGGG + Intergenic
1013839980 6:114379809-114379831 TGCCCTATTGCATCGCTAATGGG - Intergenic
1014270539 6:119330946-119330968 TGCCCACATGGAGCCCAAAGGGG - Intronic
1016627330 6:146186892-146186914 TTCCCAGTTGCACTCCAAATAGG - Intronic
1018081375 6:160262003-160262025 TGCCCACTTGCATCACAGCAGGG + Intronic
1021659016 7:22899571-22899593 TGCCCACTTTCTTCTCTAATAGG - Intergenic
1022560607 7:31345473-31345495 TGGCCCCTTACATCCCATATAGG + Intergenic
1030873956 7:114790678-114790700 TCCCAACTTGCATTCCAACTTGG - Intergenic
1030903992 7:115160198-115160220 TGCCTACTTGCAGCCTAAAGTGG - Intergenic
1031289715 7:119917801-119917823 TGCTGATTTGCATCCCAATTAGG + Intergenic
1031322145 7:120344474-120344496 AGCCCACTTCCTTCCAAAATAGG + Intronic
1031857294 7:126937880-126937902 TGCCCACCTTCTTCCCAAAGAGG - Intronic
1039105265 8:33982992-33983014 TGCACACTGGCAGCCCAAAGTGG - Intergenic
1040757601 8:50798214-50798236 TGCCAAATTGCCTCCCAAAGTGG + Intergenic
1040941247 8:52835579-52835601 TCCTCAATTGCATGCCAAATAGG - Intergenic
1042464792 8:69116081-69116103 TGCCCACCTTCATGCCAAAGTGG - Intergenic
1048049228 8:130801685-130801707 TGCCCACTGGCATCTCAGACTGG + Intronic
1051871927 9:21747920-21747942 TTCCCTGTTACATCCCAAATAGG + Intergenic
1060488820 9:124066740-124066762 TGCCAACTTGCTTTCCAAAGTGG - Intergenic
1061694616 9:132363037-132363059 TGCCCTCTGGCATCCAAAAGAGG + Intergenic
1197233720 X:124034633-124034655 TCCCCCCTTGCATATCAAATAGG + Intronic
1200308817 X:155056750-155056772 TCCCCACATGCAACCCAAAGGGG - Exonic
1201902910 Y:19061659-19061681 TGCCCTCTCCCATCCCAATTTGG - Intergenic