ID: 1081559645

View in Genome Browser
Species Human (GRCh38)
Location 11:44201775-44201797
Sequence CTGGAGCAGTAGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 744
Summary {0: 1, 1: 0, 2: 3, 3: 69, 4: 671}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081559645_1081559653 27 Left 1081559645 11:44201775-44201797 CCCTTCTCCTTCTACTGCTCCAG 0: 1
1: 0
2: 3
3: 69
4: 671
Right 1081559653 11:44201825-44201847 CAGAATCAAAATTCCATATCAGG 0: 1
1: 0
2: 0
3: 15
4: 242
1081559645_1081559648 -5 Left 1081559645 11:44201775-44201797 CCCTTCTCCTTCTACTGCTCCAG 0: 1
1: 0
2: 3
3: 69
4: 671
Right 1081559648 11:44201793-44201815 TCCAGTCCTAATTTTTTTAAAGG 0: 1
1: 0
2: 4
3: 35
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081559645 Original CRISPR CTGGAGCAGTAGAAGGAGAA GGG (reversed) Intronic
900499847 1:2998652-2998674 CTGGAGCAGGAGGAGGGGCAGGG + Intergenic
901082549 1:6591739-6591761 AGGGAGCAGAGGAAGGAGAAGGG + Exonic
901107206 1:6765809-6765831 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
901588618 1:10319751-10319773 CTGGGGTAGTGGTAGGAGAAAGG - Intronic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
902992977 1:20202583-20202605 TTGGAGAAGGGGAAGGAGAATGG - Intergenic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903605217 1:24570639-24570661 CTGGAGCAGTGGAATTTGAATGG - Intronic
903662661 1:24987863-24987885 CTGGACCATTAGCAGAAGAAGGG - Intergenic
903921831 1:26805038-26805060 CTGGAGCTGAGGCAGGAGAATGG - Intergenic
904303484 1:29571465-29571487 CTGGAGCAGTGGGAAGAAAATGG + Intergenic
904492081 1:30867482-30867504 TTGGAGGAGTAGAAAGAGCATGG - Intergenic
904933213 1:34107056-34107078 CTGGATCAGCAGCAAGAGAAAGG + Intronic
905980561 1:42222001-42222023 GAGGAGGAGGAGAAGGAGAAGGG + Intronic
906194145 1:43919548-43919570 CTAGGGCAATAGAAGGACAAGGG + Intronic
906258900 1:44371268-44371290 CTGGGGTAGTAGCAGGTGAATGG + Intergenic
906311860 1:44760021-44760043 CTGGAGCCCTAGAAGGACACGGG - Intronic
907315573 1:53568717-53568739 GTGGAGCAGGAGACAGAGAAGGG - Intronic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
907933410 1:59020579-59020601 CCAGAGCTGTAGAGGGAGAAGGG - Intergenic
908683282 1:66686214-66686236 CTGGAGCAGTGGAAGCAGCTGGG - Intronic
909344887 1:74573169-74573191 AGGGAGCAGCAGAAGCAGAAGGG - Exonic
909741802 1:79038096-79038118 CTGGAGAAGGAGAAAGAGACAGG - Intergenic
910183075 1:84506302-84506324 CTGGAGGAGGGGGAGGAGAAGGG + Exonic
910352884 1:86319566-86319588 CTAGTGCAGGAGAAGCAGAAAGG - Intergenic
910744483 1:90558464-90558486 CTGGAGCATTAGATGGGGACTGG - Intergenic
910790638 1:91046264-91046286 CTGCAGCAGTAGATGGAGCCAGG + Intergenic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
912989002 1:114465184-114465206 CTGGAACACTAGCAGGTGAAGGG - Intronic
913185210 1:116364472-116364494 ATGGTGCAGTGGAAAGAGAAGGG + Intergenic
913277249 1:117150766-117150788 GTGGAAGAGTTGAAGGAGAAAGG - Intronic
915825654 1:159073237-159073259 CTTCAGGAGGAGAAGGAGAAAGG - Exonic
916349440 1:163832329-163832351 ATGGAGAACTAGAAAGAGAAAGG + Intergenic
916880593 1:169016499-169016521 TTGCAGCAGGAGTAGGAGAAAGG - Intergenic
917332455 1:173895596-173895618 CTGGAGGTGTAGAGGTAGAATGG - Exonic
917582171 1:176390330-176390352 CTGGAGTACCTGAAGGAGAAGGG - Intergenic
917815543 1:178706202-178706224 GTGGAGGAGCAGTAGGAGAATGG + Intergenic
918626363 1:186660301-186660323 CTGGAGCAGAAGGAAGAGAGAGG + Intergenic
918722816 1:187875592-187875614 CTGGAGCAGGAGAAATAGAGGGG + Intergenic
918851170 1:189692665-189692687 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
920855609 1:209658887-209658909 CTGGAGGAGGAGAAGAGGAATGG - Intergenic
922072050 1:222204291-222204313 GAGGAGCAGTAGAGGGAGAAAGG + Intergenic
922342415 1:224668658-224668680 CTGGACCAGAAGAAGGAGGGAGG + Intronic
923062580 1:230489426-230489448 GTGGAGCAGGAGAGAGAGAACGG - Intergenic
923072437 1:230577889-230577911 AAGGAGAAGAAGAAGGAGAAGGG - Intergenic
923640791 1:235758294-235758316 CTGGGGTAGCAGAAGGAAAATGG + Intronic
924031854 1:239893654-239893676 CTGTAGCAGTAGCAGAGGAAAGG + Intronic
924049968 1:240070777-240070799 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
924291126 1:242537559-242537581 CTGGAGGAGTAGGAGGAGATAGG - Intergenic
924579419 1:245311061-245311083 ATGAAGCTGAAGAAGGAGAAAGG + Intronic
924637857 1:245805898-245805920 CTGAAGCAGTAGAAGGAACTTGG - Intronic
1062947291 10:1471257-1471279 GTGGAGCTTCAGAAGGAGAACGG - Intronic
1063216284 10:3928970-3928992 TGGGACCAGGAGAAGGAGAAAGG + Intergenic
1065318506 10:24487115-24487137 AGGGAGAAGAAGAAGGAGAAGGG - Intronic
1065624851 10:27619829-27619851 CTGGAGCAGGAGAGAGAGACGGG + Intergenic
1065772207 10:29088051-29088073 CAGTAACAGTAGAAGGTGAAGGG - Intergenic
1065786436 10:29220089-29220111 CTGGAGCAGGAGGAAGAGAGGGG - Intergenic
1065905466 10:30247327-30247349 TAGGAGCAGTTGAAGGAGGAGGG - Intergenic
1066229536 10:33418912-33418934 CGGGAGCAGAGGTAGGAGAATGG + Intergenic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1066648410 10:37634116-37634138 TTGGAGCAGAAGAAGTGGAAGGG + Intergenic
1066746456 10:38606480-38606502 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1067697677 10:48547614-48547636 CTGGTGCAGAAGGAGGTGAAGGG - Intronic
1068109626 10:52664588-52664610 CTGGAGCAGAGGAAGGGGAAGGG + Intergenic
1069323633 10:67204377-67204399 CTGGAGCAGGAGGAAGAGAGAGG - Intronic
1070052094 10:72899217-72899239 CTGAAGAAATAGAAGGGGAAAGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1071134412 10:82437152-82437174 TTGGAGTACCAGAAGGAGAAGGG - Intronic
1071676407 10:87659790-87659812 CGGGAGGAGGAGTAGGAGAAGGG + Exonic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1074227118 10:111495366-111495388 CTGGAGCAGTACAAATAAAATGG + Intergenic
1074273543 10:111979031-111979053 CTGGAGGAGGAGCGGGAGAAAGG + Intergenic
1074717918 10:116236680-116236702 ATGGAGTTGAAGAAGGAGAATGG + Intronic
1074874032 10:117600641-117600663 AGGGAGGAGGAGAAGGAGAAGGG - Intergenic
1075378241 10:121996987-121997009 CTGGAGAAGGAGAAAGAGAGTGG + Intronic
1075957755 10:126538614-126538636 CTGGAGGAGTTATAGGAGAAGGG - Intronic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1076740241 10:132479282-132479304 CTGGAGCAGGAGCTGGACAAGGG + Intergenic
1076809767 10:132880402-132880424 GAGGAGCAGTAGCTGGAGAATGG + Intronic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1077958104 11:7043161-7043183 CTGAAGCAGCAAATGGAGAAGGG + Exonic
1078060685 11:8040703-8040725 AAGGAGCAGTAGGAGGAGGAGGG + Intronic
1078093589 11:8282979-8283001 CTGTGGCAGCGGAAGGAGAAAGG - Intergenic
1078393231 11:10954768-10954790 GTGGAGCAGAAGAAAGAGAGAGG - Intergenic
1078630125 11:12995022-12995044 CTAGAGTAGTAAAAGGAGAAAGG + Intergenic
1078750963 11:14163449-14163471 CTGGAGAAATAAAAGGAGAATGG - Intronic
1079154530 11:17932598-17932620 AAGGAGCCATAGAAGGAGAAAGG + Intronic
1079190428 11:18272502-18272524 CTGTAGCAGTGGCTGGAGAAAGG + Intergenic
1079481987 11:20890884-20890906 CTGGAGTACCAGAAGGAGACAGG + Intronic
1080190000 11:29533729-29533751 CTGGAGCAGAACAAGTAAAAGGG - Intergenic
1080445838 11:32336244-32336266 GTGAAGCAGTAGAAGAAAAATGG - Intergenic
1080453690 11:32399687-32399709 ATGGAGCAGTAAAGGCAGAAAGG + Intronic
1080871727 11:36242418-36242440 CTGGAGCAGTAGAACAAGCATGG + Intergenic
1080893858 11:36432719-36432741 CTGGAGCAGAAAAAAAAGAAAGG - Intronic
1080946549 11:36980744-36980766 CTAGAGCAGGAGAAAGAGAAGGG + Intergenic
1081245880 11:40765299-40765321 CTGGAGAAGAAGAAAGAGAGAGG - Intronic
1081354637 11:42097044-42097066 CTAAAACAGTAGAAGGACAATGG - Intergenic
1081441618 11:43086954-43086976 CTGGAGCAGGAGGAAGAGAGTGG + Intergenic
1081559645 11:44201775-44201797 CTGGAGCAGTAGAAGGAGAAGGG - Intronic
1081569723 11:44282100-44282122 CTGGAACAGTAAAAGGACATTGG + Intronic
1081634829 11:44714152-44714174 CTGGAGCAGAATAAGCAGATGGG + Intergenic
1082939385 11:58687933-58687955 ATAGAGCAGTAGAAAGAGAAGGG + Intronic
1083199557 11:61112038-61112060 CTGGAGCAGTAGAAAGTCATCGG + Intronic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1084045305 11:66564649-66564671 CTGGAGGTGGAGAAGGAGTAGGG + Intronic
1084094842 11:66904290-66904312 CTGGAGCTTTGGAAGGATAATGG + Intronic
1084112226 11:67021846-67021868 CTGGAACAGAACAAAGAGAAAGG - Intronic
1084653026 11:70500120-70500142 GTGGGGCACTAGAAGGAGAAGGG - Intronic
1084681112 11:70666976-70666998 CAGGAGCTGTGGAAGGTGAAGGG + Intronic
1085462390 11:76701990-76702012 CTGGATCAGAACGAGGAGAAGGG + Intergenic
1085697249 11:78715454-78715476 CTGGAGCAGTGCAGGGAGACAGG - Intronic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086218785 11:84416102-84416124 CTGGAGCACAAAATGGAGAAGGG - Intronic
1087091162 11:94274569-94274591 CTCCAGCAGCAGAAGGAGAGAGG - Intergenic
1087165712 11:95000217-95000239 TTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1087168703 11:95028649-95028671 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1087540964 11:99519140-99519162 CTGGAGCAGTCTAAGTACAAAGG - Intronic
1087594743 11:100238490-100238512 CAGCAGCAGGAGGAGGAGAAGGG + Intronic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088989311 11:114938025-114938047 GTGGAGCAGGAGAAAGAGAGAGG - Intergenic
1089283609 11:117391712-117391734 CTGGAGTAGAAGAGGGAGTATGG - Intronic
1089503379 11:118946455-118946477 GGGGAGCAGTGGAAGGAGAGTGG - Intronic
1089744911 11:120609842-120609864 AAAAAGCAGTAGAAGGAGAAAGG - Intronic
1089804998 11:121078739-121078761 CTAGAGCAGCAGAAGCAGTAAGG - Intronic
1090009154 11:123030567-123030589 CTGGAGTCGTATAAGTAGAATGG + Intergenic
1091180433 11:133599575-133599597 ATGGAGCAAAAGCAGGAGAATGG - Intergenic
1091231087 11:133988511-133988533 ATGGAGCGGGAGAAGGGGAAAGG - Intergenic
1091600388 12:1914449-1914471 CTCGGGCCGTAGAAGGTGAAAGG - Intronic
1091662286 12:2393365-2393387 CTGGAGCAGGAGATGGTGGAGGG - Intronic
1092088287 12:5783821-5783843 CTGGAGCCCTAGTGGGAGAAGGG - Intronic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1092597244 12:10021057-10021079 CTGGAGCAGGAGCAGGAGAGAGG - Intergenic
1093084554 12:14852403-14852425 TGGGAGAAGGAGAAGGAGAAGGG - Intronic
1093092638 12:14938505-14938527 CAGGAGCAGGAGAGGGACAATGG - Exonic
1093303552 12:17482414-17482436 CTGGTACCGTAGAAAGAGAAGGG + Intergenic
1093483277 12:19627140-19627162 CTGGAACAGTGGAAGGCTAAAGG + Intronic
1095174627 12:39077439-39077461 CAGGAGCAGTGGGAGGACAAAGG + Intergenic
1095903914 12:47357759-47357781 CTGGAGCAGTAGCACGATGAAGG + Intergenic
1096005643 12:48168850-48168872 CTGGAGCAGCCGGAGGAGCACGG + Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096781056 12:53992339-53992361 ATGGAGCTATAGAAGGGGAAGGG - Intronic
1096878268 12:54647092-54647114 CTGGGGCAGGAGGAAGAGAAAGG + Intronic
1097033639 12:56107362-56107384 CTAGAGAAGCAAAAGGAGAAAGG + Intronic
1097410223 12:59243334-59243356 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1097749118 12:63332129-63332151 CTGGAGTACCAGAAGGAGACAGG + Intergenic
1099244958 12:80183581-80183603 CTGGAGCTCAAGAAAGAGAATGG + Intergenic
1099344044 12:81475815-81475837 CTGGAGGCTGAGAAGGAGAATGG - Intronic
1099637514 12:85233292-85233314 CTAGATAAGCAGAAGGAGAATGG + Intronic
1100214410 12:92432998-92433020 CCAGAGCAGGAGAAAGAGAAGGG + Intergenic
1100399547 12:94217020-94217042 CAGGTGCAGTGGAAGGAGAGAGG - Intronic
1101568386 12:105931141-105931163 CTGGAGCAGCAAAGGGATAAAGG + Intergenic
1101766822 12:107708666-107708688 CTAGAGCAGTAGAAGAAAAGAGG - Intronic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102658258 12:114501926-114501948 GGGGAGCAGGAGAAGGAGAAAGG + Intergenic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1102924222 12:116814583-116814605 CTGGAGCAGAAGAAGGGGCAGGG + Intronic
1102927229 12:116835614-116835636 CTGGAGTGCTAGATGGAGAAGGG + Intronic
1103620816 12:122186140-122186162 CTGTAGCAGGAGAGGGAGCACGG - Intronic
1103851560 12:123936920-123936942 CAAGAGAAGCAGAAGGAGAATGG + Exonic
1103876646 12:124132680-124132702 CTGGGCCAGCAGAATGAGAATGG - Intronic
1104782775 12:131432515-131432537 CAGGAGGAGGAGGAGGAGAAGGG + Intergenic
1105431051 13:20338381-20338403 CTAGAGCAGTCAAAAGAGAAAGG + Intergenic
1105544861 13:21343982-21344004 GAGGAGGAGAAGAAGGAGAAGGG - Intergenic
1105703202 13:22949070-22949092 GTGGAGCAGAGTAAGGAGAATGG - Intergenic
1105855897 13:24371544-24371566 CTGGAGCAGAGTAAGGAGAATGG - Intergenic
1106143942 13:27035301-27035323 CTGGAGCAGAGAGAGGAGAAGGG + Intergenic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1106463424 13:29992281-29992303 CAGGAGCAAGAGAATGAGAAGGG - Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1107347826 13:39481900-39481922 CTGGAGCAGTAGAGAGATGATGG + Intronic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1108160568 13:47633848-47633870 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1108283353 13:48881448-48881470 CTGGAGAAGAGAAAGGAGAATGG + Intergenic
1109391104 13:61694857-61694879 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1109399010 13:61800055-61800077 ATGGAGAATGAGAAGGAGAATGG + Intergenic
1109548620 13:63861449-63861471 CTGTAGCTGTACAAGGAGCATGG - Intergenic
1111175909 13:84596085-84596107 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1111746018 13:92270413-92270435 CAGGAGCAGGAGAAAGAGAGAGG - Intronic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1113110175 13:106814287-106814309 AAGGAGCAGGAGAAGGGGAAGGG + Intergenic
1114248217 14:20934412-20934434 CTAGAGAAGTGGGAGGAGAAGGG - Intergenic
1115813269 14:37133686-37133708 CTGGAGGAGGGGAAGGAGACAGG - Intronic
1115970835 14:38943146-38943168 CAGGTACAGAAGAAGGAGAATGG + Intergenic
1116475344 14:45332794-45332816 CAGGAGCAGTAGAGGGAGATTGG + Intergenic
1118108579 14:62690007-62690029 CGGGATCAGTAGAGTGAGAATGG + Intergenic
1118342527 14:64906855-64906877 CGGGAGATGGAGAAGGAGAAAGG - Intergenic
1118723412 14:68609751-68609773 CTGGAGAAGAGGAAGGTGAAAGG - Intronic
1118995418 14:70831291-70831313 GAGGAGGAGTGGAAGGAGAAAGG - Intergenic
1119389045 14:74277749-74277771 CTGGAGCTGGAAGAGGAGAAAGG - Intergenic
1119451153 14:74712004-74712026 CTTGATCAGTAGCTGGAGAATGG + Intronic
1119539579 14:75429107-75429129 CTGGGTCAGTAGGAGGAGCAGGG + Intronic
1119799126 14:77427041-77427063 CTGGGGCAGCAGAGGGAAAATGG + Exonic
1120014215 14:79451730-79451752 CTGGAGCAGCAGAATGCAAAGGG - Intronic
1120575956 14:86181135-86181157 CAGAAGCAGAAGAAGGGGAAGGG + Intergenic
1121111143 14:91313936-91313958 TTGGAGCAGGCCAAGGAGAAGGG - Exonic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1121943784 14:98098888-98098910 CTGGGGCAGCAGAGGGAGAGGGG + Intergenic
1122302012 14:100736840-100736862 CGGGAGCTGGAGAAGGGGAAGGG - Exonic
1122556482 14:102583503-102583525 CTGGAGCAGTGCAAGCAGGACGG + Intergenic
1122844790 14:104486976-104486998 CTGGAGCAGAGTAATGAGAATGG - Intronic
1122886934 14:104714343-104714365 CTGGAGCAGTTGGAGGAGGGTGG + Exonic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1124769470 15:32519076-32519098 CTGCAGCAGGAGAACGAGAGAGG + Intergenic
1125525408 15:40370931-40370953 GTGCAGCAGGAGAAGGAGGATGG + Exonic
1126129302 15:45325021-45325043 TAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1126552838 15:49952311-49952333 TTGGAGGACCAGAAGGAGAAGGG - Intronic
1126829561 15:52587067-52587089 CAGCAGCAGTAGCAGGAGAAAGG + Intronic
1126841774 15:52724411-52724433 CTGGATTGGTAGAAGGAGAAAGG - Intergenic
1126896358 15:53261230-53261252 CTGGAGTAGGAGAAGCAGACTGG + Intergenic
1127503179 15:59573603-59573625 CTGGAGATGTAGATGGAGACAGG + Intergenic
1128056408 15:64702978-64703000 CTGGAGCAGATGAGGGAGGATGG + Intronic
1128171477 15:65517449-65517471 CCGGCGCAGGAGAAGGAGAAGGG + Intronic
1128500411 15:68223308-68223330 CTGGAGCCAGAGAAAGAGAAGGG + Intronic
1128939533 15:71777160-71777182 CTGGACCAGTGGGAAGAGAAAGG - Intronic
1129355977 15:74992098-74992120 GTGGAGCACTAGTAGGAGAGAGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130655868 15:85791902-85791924 CAGGAGCAGTGGAAAGAGCATGG - Intronic
1131609516 15:93946626-93946648 AAGGAGCTGTAGGAGGAGAAAGG - Intergenic
1131614673 15:94003938-94003960 AGGGGGCAGCAGAAGGAGAATGG - Intergenic
1131694000 15:94856111-94856133 CTGGAGCAGACCAAGAAGAAAGG + Intergenic
1131875145 15:96798019-96798041 ATGGAGGAGGAGAAGGAAAAGGG + Intergenic
1131885022 15:96903175-96903197 GAGGAGCAGTAGAAGGAGATTGG - Intergenic
1132042745 15:98538652-98538674 TTGGAGAACTAGAAGGAGCAAGG - Intergenic
1132610185 16:812002-812024 CAAGAGCAGGACAAGGAGAATGG + Intronic
1132917047 16:2355153-2355175 CTGGAGCAGGAGGAAGAGAGTGG + Intergenic
1132992538 16:2804317-2804339 CTGGAGCAGGGAGAGGAGAAAGG - Intergenic
1133070582 16:3244124-3244146 CTGGAGCAAAGGTAGGAGAAAGG - Intronic
1134102345 16:11461092-11461114 CTGGAGAGGAAGGAGGAGAATGG - Exonic
1135655090 16:24241409-24241431 AAGGAGCAGTAGAGGGAAAAGGG + Intergenic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136168233 16:28470711-28470733 GTGGAGGAGGAGAAGAAGAAAGG + Intronic
1136172246 16:28496213-28496235 ATGGAGCAGTCCCAGGAGAAAGG + Exonic
1136309489 16:29397839-29397861 CTGGAGGAGGAGAAGAAGAAAGG + Intronic
1136624500 16:31453734-31453756 CTGGGGGAGAAGAAGGAAAACGG + Intergenic
1136736605 16:32473162-32473184 CTGGGGCAGGGGAAGGAAAATGG - Intergenic
1137293163 16:47065974-47065996 CTGGAGGAGGAGAGGGAGAAAGG + Intergenic
1137979258 16:53055665-53055687 CTGGAGGAATAGGAGGAGGAGGG - Intronic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138371629 16:56531505-56531527 CTGGAGCAGAAAAAGGACATTGG + Intergenic
1139031174 16:62882704-62882726 CTGGAGCAGAAGGACGAGGAAGG + Intergenic
1139493952 16:67302569-67302591 CTGGGGCAGTAGGGGGAGAGAGG + Intronic
1139632510 16:68239129-68239151 CTGGAGCCCTAGATAGAGAAGGG - Intergenic
1139659860 16:68413276-68413298 CTGGAGCAGAGGCAGAAGAAGGG - Intronic
1139949620 16:70662773-70662795 CTGGAGCAGTAGGAGGTGTGGGG - Exonic
1140027257 16:71301829-71301851 CTGGAGCAGTGAAAGGATGAAGG + Intergenic
1140155803 16:72425787-72425809 CGGGAGGAGGAGAAGAAGAAGGG + Intergenic
1140199620 16:72884629-72884651 CAGGAGGAGGAGAAGGAGAAAGG + Intronic
1140452705 16:75083858-75083880 CAGGAGTACTAGAAAGAGAAAGG + Intronic
1141775574 16:86120914-86120936 CTAGAGGAGGAGGAGGAGAAGGG - Intergenic
1142103412 16:88288077-88288099 TTGGAGCAGCAGGAGGAAAAAGG - Intergenic
1142169147 16:88611481-88611503 AAGGAGCGGGAGAAGGAGAAGGG + Exonic
1203016463 16_KI270728v1_random:356415-356437 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1203034798 16_KI270728v1_random:629573-629595 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1143080168 17:4375764-4375786 CTGGAGTAGAAGGAAGAGAAGGG + Intergenic
1143080420 17:4377313-4377335 CTGGAGTAGAAGGAAGAGAAGGG - Intergenic
1144071693 17:11679706-11679728 TTCGAGAAGTAGAACGAGAATGG + Intronic
1144136700 17:12302117-12302139 CTGGAGACCGAGAAGGAGAATGG - Intergenic
1144227442 17:13163390-13163412 CTGGAGCAGGAGCAAGAGATGGG + Intergenic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144498438 17:15765091-15765113 CAGGAGCTGAAAAAGGAGAAAGG - Intergenic
1144546144 17:16197751-16197773 CTGGAGCAGTTGCAGGTGTATGG - Intronic
1144555546 17:16279634-16279656 CTGGAGCAAGAGAAGGACAATGG - Intronic
1144584608 17:16480731-16480753 CTGTAGCAGGAGAAGGAGATGGG - Intronic
1145161820 17:20580132-20580154 CAGGAGCTGAAAAAGGAGAAAGG - Exonic
1146542795 17:33712043-33712065 ATGTAACAGTAGATGGAGAAAGG + Intronic
1146583105 17:34057512-34057534 CTGGAGCTTTAGTAGGAGGACGG + Intronic
1146630301 17:34464769-34464791 TGGGAGGAGTAGCAGGAGAAGGG - Intergenic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1146714047 17:35068789-35068811 ATGGAGGAGGAGGAGGAGAAAGG + Intronic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1147269323 17:39256379-39256401 CTAAAGCAGTAAAAGGATAATGG - Intergenic
1149174606 17:53854293-53854315 TTGGAGTAACAGAAGGAGAAGGG + Intergenic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1150510949 17:65752539-65752561 CTGGAGAGGTGGAATGAGAAAGG - Intronic
1150653834 17:67026900-67026922 CTGGGGCAGGAGAGAGAGAAAGG - Intronic
1151354265 17:73549208-73549230 AGGGAGGAGTAGAAGGAGAGAGG + Intronic
1151415985 17:73964659-73964681 TTGGAGTACTAGAAGGAGAGGGG - Intergenic
1151660379 17:75515484-75515506 TTGGAAAAGGAGAAGGAGAAAGG - Exonic
1151868071 17:76818059-76818081 CTGGAGCAGGAGGAAGAGAGGGG + Intergenic
1151980070 17:77503371-77503393 CTGGAGCAGGAGAGGAAGCAGGG - Intergenic
1152105193 17:78324612-78324634 CTGGAACTGAAAAAGGAGAAGGG - Intergenic
1152331693 17:79677322-79677344 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
1152340306 17:79720744-79720766 ATGGAGCAGGAGCAGGAGCAGGG - Intergenic
1152354705 17:79801121-79801143 CTGGAGCACTCCAAGGAGAGGGG + Intronic
1152565126 17:81096954-81096976 GAGGAGGAGAAGAAGGAGAAAGG + Intronic
1152589418 17:81204076-81204098 CTGGAGGATTAGAAACAGAAGGG + Intronic
1154124143 18:11674633-11674655 GTGGAGCAAGAGAAAGAGAAAGG + Intergenic
1154344878 18:13533397-13533419 CTAGAGCATTTTAAGGAGAAAGG + Intronic
1155185502 18:23383529-23383551 CAGGAGCAGCAGAAGGTGACAGG + Intronic
1156232900 18:35172236-35172258 CTGGGGCAGTGGCAGGAGCATGG - Intergenic
1156504163 18:37578307-37578329 CTAGAGGAGTAAAAGGAGAGTGG - Intergenic
1156822148 18:41385880-41385902 CTGGAGCAGTGATAGGTGAATGG + Intergenic
1157584204 18:48790892-48790914 ATGGCCCAGCAGAAGGAGAAGGG - Intronic
1158248193 18:55455219-55455241 AAGGAGAAGTAGAAGAAGAAAGG + Intronic
1158894601 18:61901173-61901195 CTGGAGCAGCAGGAGGGGAGGGG - Intergenic
1158963469 18:62604811-62604833 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1159040535 18:63319906-63319928 CAGGACCAGGAGGAGGAGAAAGG - Exonic
1159491498 18:69140743-69140765 ATGGAGCAAGAGAAGAAGAAGGG + Intergenic
1160057656 18:75499541-75499563 AAGGAGTAGGAGAAGGAGAAGGG + Intergenic
1160119849 18:76120569-76120591 CTGGAACAGTAGAATGACAAAGG + Intergenic
1161379850 19:3959123-3959145 CTGGAGCAGGAGAAGCTGCAGGG - Exonic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1162082984 19:8230140-8230162 TGGGAGTACTAGAAGGAGAAAGG - Intronic
1162461560 19:10816924-10816946 CTGGAGCAGCAGTGGGAGAAGGG + Intronic
1163077521 19:14907880-14907902 CTGGGGCAGTTGAGGGAGAAGGG + Intergenic
1164718705 19:30415256-30415278 GAGGAGCAGGAGGAGGAGAAGGG - Intronic
1165004767 19:32795838-32795860 CTGGAGCAGGAGCAGGAGCAGGG + Intronic
1165741992 19:38210233-38210255 CGGGAGGAGGAGAAGGAGGACGG - Intergenic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1166652131 19:44582648-44582670 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1166853042 19:45769415-45769437 CAGGCGCAGTGGAAGGAGGATGG + Intergenic
1167158146 19:47751561-47751583 CTGGAGCAGACCAAGAAGAAAGG + Exonic
1167406134 19:49309982-49310004 ATGGAGAAGTAGAAGTAGAAGGG - Intronic
1167463381 19:49638103-49638125 CCTGAGCAGGAGAAGGAGACGGG - Intronic
1167608258 19:50493209-50493231 GAGGAGAGGTAGAAGGAGAATGG + Intergenic
1167776957 19:51564720-51564742 CTGGGGTAGGAGAAGGAGCAGGG + Intergenic
1167779928 19:51592688-51592710 GGGGAGGAGGAGAAGGAGAAGGG + Intergenic
1167980737 19:53272907-53272929 CTGGGACATTTGAAGGAGAAGGG + Intergenic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
1168269094 19:55240034-55240056 CTGGTGCAGAACACGGAGAAGGG - Exonic
1168647148 19:58066953-58066975 CTGGAGCAGTGGCAGAGGAATGG + Exonic
925553452 2:5101982-5102004 GGGGATTAGTAGAAGGAGAAGGG + Intergenic
925839647 2:7979588-7979610 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
926033346 2:9612594-9612616 CTGGACCAGTAGGAGGAGTGTGG + Intronic
926421012 2:12699392-12699414 GAGGATCAGGAGAAGGAGAAGGG + Intergenic
926776190 2:16425602-16425624 CTGGGGCTGTAGAAGGGGTAGGG - Intergenic
926801495 2:16664614-16664636 CTGGGGCAGCAGGAGGAGAGTGG - Intronic
927123001 2:19986029-19986051 CTGGAGCTATAGAGGGAGCAGGG + Intronic
927882223 2:26696872-26696894 CTGAACAAGTAGAAGGAGTAGGG - Intronic
928345937 2:30496091-30496113 CTAGAGCAGGAGGAAGAGAAAGG + Intronic
928739289 2:34331318-34331340 CGGGAGCTGAAGCAGGAGAATGG - Intergenic
928949984 2:36805903-36805925 CTGGGGCTGTGGAAGGAGCAAGG - Intronic
929000493 2:37343599-37343621 CTGGAGCTGTAGGAGAAGACAGG - Intergenic
929253418 2:39782999-39783021 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
930189796 2:48445709-48445731 TGGGAGCAGGAGCAGGAGAAAGG + Intronic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931671113 2:64648707-64648729 CTGGAGCTTTAGAAGGAGGCAGG + Intronic
932476354 2:72008771-72008793 CGGGAGCACCAGGAGGAGAAGGG + Intergenic
932757447 2:74418153-74418175 CTGGAGAAGGAGGAAGAGAAGGG - Intronic
933129645 2:78656346-78656368 CTGGAGCACCTGAAGGAGACAGG + Intergenic
933502874 2:83138874-83138896 AAGGAGCAGGAGAAGGAGAAGGG + Intergenic
934187759 2:89762279-89762301 CTGGGGCAGGGGAAGGAAAATGG - Intergenic
934308858 2:91845669-91845691 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
934565596 2:95338703-95338725 CTCGAGCGGAAGAAGGAGAGAGG + Intronic
934882553 2:97996144-97996166 CTGGCGCAGGAGAAGGAGGGAGG + Intergenic
935051832 2:99530876-99530898 CTGGAGCAGCACAAGGAGGGTGG - Intergenic
935394186 2:102588157-102588179 CTAGATCACTTGAAGGAGAAAGG - Intergenic
935499010 2:103815448-103815470 CTGGAGCAGAATTAGGAAAATGG - Intergenic
935506572 2:103911984-103912006 CTGGAGTACCAGAAGGAGACAGG + Intergenic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936732407 2:115400025-115400047 CTGGAGCAGGAGCAAGAGACGGG + Intronic
936768091 2:115877985-115878007 AGGGAGAAGGAGAAGGAGAAAGG - Intergenic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937686812 2:124706847-124706869 GAGGAGGAGGAGAAGGAGAAGGG + Intronic
937791460 2:125967052-125967074 TTGGAGCAGAAGGAGGAGATTGG - Intergenic
937931664 2:127209890-127209912 CTGGAGCACCAGAAGGAGACGGG + Intronic
939023366 2:136984438-136984460 CAGGAGCAAGAGAAGGAGCAAGG - Intronic
939809126 2:146809409-146809431 CTGGAGTACCAGAAGGAGATGGG + Intergenic
940033976 2:149293969-149293991 CTGAAGGATTAGAAGGAGCAGGG + Intergenic
940269299 2:151874001-151874023 CTGGAGCAGGAGGAAGAGACGGG - Intronic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
940757426 2:157699228-157699250 CTGGGTCAGAAGAAGGAGCAGGG + Intergenic
941762947 2:169264874-169264896 CTGGAGGAGCTGAAGCAGAATGG + Intronic
942481714 2:176395165-176395187 TTGGAGTAGTTGAAGGATAAGGG - Intergenic
942889762 2:180975209-180975231 CTGGAGGAGTATTATGAGAAGGG - Intronic
943004937 2:182377308-182377330 CAGGAGCAGGAGAAAGATAAAGG - Intronic
943119208 2:183712492-183712514 CGGGAGAAGTGTAAGGAGAAAGG - Intergenic
943299492 2:186180159-186180181 CAGGGGCAGTAGAGGGAGACAGG - Intergenic
944074030 2:195706763-195706785 ATGGGGCAGTAGATGAAGAAGGG - Exonic
944155266 2:196600947-196600969 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
944155613 2:196604270-196604292 CTGGGGCAGTGGAAGGGGCATGG - Intergenic
944461345 2:199954149-199954171 CTGGAGCAGTGGCAGGATCATGG + Intronic
944984636 2:205161535-205161557 CTGGAACAACAGTAGGAGAATGG - Intronic
945013200 2:205486627-205486649 CTGGAGCAGGAGGAAGAGAGTGG + Intronic
945192280 2:207201362-207201384 ATGGTGCAGTAGAAAGAGAATGG - Intergenic
946095827 2:217273450-217273472 CTGGGGCAGTTGGAGGAGGATGG - Intergenic
946153418 2:217791293-217791315 CTGGAGAAAGAGAATGAGAAAGG - Intergenic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
947572029 2:231243626-231243648 ATGATTCAGTAGAAGGAGAATGG - Intronic
948078993 2:235190085-235190107 CTGGAGCCGAAGGAGGAGATGGG - Intergenic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948538992 2:238672320-238672342 AAGGAGGAGAAGAAGGAGAAGGG - Intergenic
948590008 2:239043214-239043236 CTGGAGCAGGAGCAAGAGATGGG - Intergenic
1168889623 20:1286402-1286424 CTGCAGCTGGAGAGGGAGAAGGG + Intronic
1169518538 20:6345456-6345478 CTGGAGCAGGAGGAAGAGAGGGG + Intergenic
1169561215 20:6802838-6802860 GAGGAGAAGGAGAAGGAGAACGG - Intergenic
1169577284 20:6979240-6979262 CTGTAGCAGTAAAGGAAGAAAGG + Intergenic
1169846316 20:9996008-9996030 CTGGAGCACAAGAAGGACATAGG + Intronic
1169974280 20:11305964-11305986 GTTGGGAAGTAGAAGGAGAAAGG + Intergenic
1170083698 20:12505556-12505578 CTGTAGCAGTGGAAGTAGGAGGG + Intergenic
1170426220 20:16237823-16237845 CTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1171155026 20:22864167-22864189 CTAGTGCACTTGAAGGAGAATGG - Intergenic
1171209047 20:23302904-23302926 ATGGAGAGGTTGAAGGAGAAGGG + Intergenic
1171941186 20:31331312-31331334 GAGGAGCAGGAGAAGGAGGAGGG + Intergenic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172373354 20:34414835-34414857 CTACAGAAGTAGAAGGGGAATGG - Intronic
1172648243 20:36484757-36484779 CTGGAGCCCTAGAAGGAACAAGG + Intronic
1172981002 20:38941636-38941658 GTGGAGGAATAGAAGGTGAATGG + Intronic
1173856850 20:46255724-46255746 CTGGAGCAGGAAAAGGAAGAAGG - Intronic
1173951456 20:46996848-46996870 CTGGAGCAGGAGGAAGAGAGGGG + Intronic
1174159471 20:48540764-48540786 GTTGAGCAGGAGAAAGAGAAGGG - Intergenic
1175116132 20:56683811-56683833 CTGGAGCAGAAGCAGCAGAGAGG + Intergenic
1175128999 20:56775118-56775140 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1175581008 20:60099712-60099734 ATGGACCAGTAGAAGTGGAAAGG + Intergenic
1175780199 20:61677188-61677210 CTGGAGTAGGGGAAGGAGCAGGG + Intronic
1175919671 20:62444791-62444813 CTGGGGCAGGAGAAGGAGGGTGG + Intergenic
1176115024 20:63428436-63428458 CTGGGGCAAGAGAAGGAGAGGGG + Intronic
1177249368 21:18572253-18572275 GAGGAGGAGGAGAAGGAGAAAGG + Intergenic
1178056369 21:28803470-28803492 CTGTAGCAGTAGATTGAGATTGG - Intergenic
1178158377 21:29881697-29881719 ATGGTGCAGTAGAAGAAGAAAGG - Intronic
1178285490 21:31322269-31322291 CAGGAGGAGAAGAAGGAGCAAGG - Intronic
1178507838 21:33177221-33177243 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1179145084 21:38760994-38761016 CTGGAGTGAAAGAAGGAGAAAGG - Intergenic
1179951289 21:44710128-44710150 CTCGAGCAGGGGAGGGAGAAAGG + Intronic
1180138475 21:45876430-45876452 CTGGAGCAGGGGAAGGTGAGCGG + Intronic
1180535941 22:16392757-16392779 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1181436780 22:22915726-22915748 CAGGAGCCATAGAAGGAAAATGG + Intergenic
1181828477 22:25539349-25539371 CTGGAACAGAAGAAGGAGATTGG - Intergenic
1182263055 22:29089741-29089763 CTGGAGCAGGAGAATGAGCAGGG - Intronic
1182294426 22:29304844-29304866 CTGAGGCAGGAGAAGGAGAATGG - Intergenic
1182332276 22:29559678-29559700 GTGGGGCAAGAGAAGGAGAAGGG - Intronic
1182556989 22:31134485-31134507 CTGGAGGAGCAGCAGGAGAGAGG - Exonic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182996294 22:34815959-34815981 CTGGAGCAGGAGAAAGAGACGGG + Intergenic
1183680949 22:39328827-39328849 CTGGAGCAGTAGGACAAGCAAGG + Intergenic
1184437831 22:44490334-44490356 CTGGAGCAGGTGCAGGAGAGAGG + Intergenic
1184561146 22:45263630-45263652 GTGGAGCAGAAGAAGGAGCCGGG - Intergenic
1184600212 22:45539056-45539078 GAGGAGGAGGAGAAGGAGAAAGG - Intronic
1184915661 22:47567302-47567324 CTGGTGCGCTAGAAGGAGAGGGG - Intergenic
1184956404 22:47889718-47889740 CTGGAGCAGGAGAAAGAGAGAGG - Intergenic
1185141916 22:49107327-49107349 CAGGATCATTAGAAGCAGAAAGG - Intergenic
1185251483 22:49804042-49804064 CTGGAGCTGTAGGAGGAGTCGGG - Intronic
949501379 3:4683430-4683452 GTGGAGCAGGACACGGAGAAAGG - Exonic
949667632 3:6358703-6358725 CAGGAAGAGAAGAAGGAGAAAGG - Intergenic
949700271 3:6748673-6748695 AAGGAGGAGGAGAAGGAGAAGGG - Intergenic
950360931 3:12448869-12448891 GTGAAGCAGGACAAGGAGAAGGG - Intergenic
950962399 3:17119803-17119825 GAGGAGGAGGAGAAGGAGAAAGG - Intergenic
952871832 3:37907533-37907555 GTGGAGGAGGTGAAGGAGAAAGG + Intronic
952879317 3:37973467-37973489 CTGGAGTAGCAGCAAGAGAAGGG - Intronic
953150556 3:40320435-40320457 CTGGAGTAGGGGAAGAAGAAGGG + Intergenic
953757311 3:45657853-45657875 ATGGAGCAGTACAAGGATACAGG - Intronic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
955086588 3:55708761-55708783 ATGGAGGAGTGGAAGAAGAAAGG + Intronic
957212082 3:77272393-77272415 CAGGAGCAGGAGGAAGAGAAGGG + Intronic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
958032516 3:88129781-88129803 CTGGAGCTGTGGAATAAGAAAGG - Exonic
959171709 3:102852147-102852169 CTGGAGCAGGAGAAAGGGAATGG - Intergenic
959346462 3:105201210-105201232 CCAGAGCAGTAGAAAGAGAGTGG + Intergenic
960155577 3:114294381-114294403 AAGGAGCAGGAGAAGAAGAAGGG + Intronic
960583703 3:119301713-119301735 CTGCAGCAGTGGGTGGAGAAAGG + Intronic
961073581 3:123961334-123961356 CTGGAGCAGGAGAAAGGGAGTGG - Exonic
961094828 3:124145205-124145227 CTGGATCAGTAGATCGATAAAGG - Intronic
961328528 3:126125743-126125765 CTGGTGGAGAAGAAGGACAAAGG - Intronic
961370668 3:126427902-126427924 CTGGAGCAGCAGCAAGAGAATGG + Intronic
961508015 3:127384223-127384245 CTGGAGCAGGAGGAGGAGGTGGG + Intergenic
962304787 3:134276218-134276240 CCAGAGCAGTGGAAGGAAAAAGG + Intergenic
962324532 3:134422462-134422484 CAGGAGCAAGAGAAGGAGAGGGG - Intergenic
962735455 3:138321596-138321618 CTGGAGCAGCTGAAAGAGCATGG - Intronic
963433390 3:145237610-145237632 CTGGAGAAGGAGAGGCAGAATGG - Intergenic
963762058 3:149294284-149294306 CTGGGCCTATAGAAGGAGAAAGG - Intergenic
963867565 3:150379032-150379054 CTGGAGCAGGAGCAAGAGATGGG - Intergenic
964388028 3:156169993-156170015 CTTGGGCAGTAGAGGGAAAAAGG - Intronic
964861634 3:161208977-161208999 TATGAGCAGTTGAAGGAGAATGG - Intronic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965076007 3:163977309-163977331 CTGGAATAAAAGAAGGAGAAGGG - Intergenic
966066375 3:175826798-175826820 TTGGAGCAGAAGGATGAGAAAGG - Intergenic
966690961 3:182740942-182740964 CTGTAACAGTAGAATGAGCAAGG - Intergenic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
967031285 3:185609747-185609769 CAGGAGGAGGTGAAGGAGAAAGG - Intronic
967332820 3:188308966-188308988 AGGGAGGAGGAGAAGGAGAAAGG - Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967495620 3:190142054-190142076 GTGGACAACTAGAAGGAGAAGGG - Intergenic
968692278 4:1998676-1998698 CTGGAGTACCAGAAGGAGACGGG + Intronic
968904493 4:3445143-3445165 CTGGAGCAGTGGGAAGAGAGTGG - Intronic
969448238 4:7257531-7257553 GTGGGGCAGGAGAGGGAGAAGGG - Intronic
969457458 4:7308299-7308321 CTGGAGCAGCAGAAGGGGCAGGG - Intronic
969608980 4:8216646-8216668 CTGGGGCAGTCCATGGAGAAGGG + Intronic
969689714 4:8697855-8697877 CAGGAGCAGGAGAAGCAGGAAGG - Intergenic
970516181 4:16833025-16833047 GTGGAGCATTGGAAGGAGCAAGG - Intronic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971725312 4:30304187-30304209 TTGGAGCAGGAGAAAGAGAGAGG + Intergenic
972280929 4:37601592-37601614 CTGAAGCAATAAAAGGAAAAGGG + Intronic
973530897 4:51835961-51835983 GTGGAGCAGTGGGAGGAGGAAGG - Intergenic
973846854 4:54921574-54921596 CTGGAGCAGGAGCAAGAGAGAGG - Intergenic
973916195 4:55636654-55636676 CTGGAAGAGGTGAAGGAGAAAGG - Intronic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974229637 4:59092825-59092847 CTGGTACTGAAGAAGGAGAAAGG - Intergenic
974413189 4:61568481-61568503 TTGAAGCAGTAGAAGAAGAAAGG + Intronic
975294576 4:72718144-72718166 CTGGGGGAGTTGAAGGAGAATGG + Intergenic
976777179 4:88719570-88719592 GAGGAGGAGAAGAAGGAGAAAGG - Intergenic
976974944 4:91154484-91154506 CAGGAGCAGGAGCAGGAGCAGGG - Intronic
978269920 4:106876663-106876685 GTGGAGCAGGAGAGGGAGAGGGG - Intergenic
978885356 4:113761467-113761489 CAGGAGGAGTAGAAGCAGAGGGG + Intronic
980079383 4:128327917-128327939 ATTGAGCAGTAGGAGGATAAGGG - Intergenic
980158459 4:129133473-129133495 CAGGAGCTGAAAAAGGAGAAAGG - Intergenic
980314864 4:131185669-131185691 TTGGTGCTGTAGATGGAGAAAGG + Intergenic
980669683 4:135988022-135988044 ATGAAGTAGTAGTAGGAGAAAGG - Intergenic
981025047 4:140069453-140069475 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981025062 4:140069514-140069536 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982285518 4:153729673-153729695 ATGGAGCAATCAAAGGAGAATGG - Intronic
982560307 4:156921478-156921500 AAGGAGGAGGAGAAGGAGAAAGG + Intronic
983535124 4:168849428-168849450 CTGCAGAAGAAAAAGGAGAAAGG + Intronic
983780674 4:171666456-171666478 CAGGAGCAGGAGAAAGAAAAAGG - Intergenic
984483685 4:180337960-180337982 GTGGTGAAGTAGAAGGATAATGG - Intergenic
985285521 4:188332947-188332969 CTGGAACAGGAGAAGGAGCTTGG + Intergenic
985802656 5:2015445-2015467 CTGGAGCATGCGAAGGACAAGGG + Intergenic
985985596 5:3513461-3513483 CGGGAGAGGCAGAAGGAGAAGGG + Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986390452 5:7281121-7281143 CTGGAGCAATAGAAGGGCAGGGG - Intergenic
986392666 5:7300591-7300613 CTGAAGCAGAAGAAGCAGATGGG - Intergenic
986898588 5:12402874-12402896 CAGGAGGAGAAGAAAGAGAATGG - Intergenic
987726759 5:21712173-21712195 CTGAAGCACTAGAATTAGAAGGG + Intergenic
988059646 5:26150046-26150068 CTGGAGTACCAGAAGGAGACAGG + Intergenic
988815088 5:34826766-34826788 CTGTTGCAGAAAAAGGAGAAGGG - Intronic
988879869 5:35490121-35490143 CTGGATCAGTTGTAGGGGAAAGG - Intergenic
989087873 5:37695151-37695173 CAGGAGCAGGAGTAAGAGAAGGG + Intronic
989717238 5:44478676-44478698 AAGGAGCAGTTGAAGGAGTAAGG + Intergenic
990184379 5:53197753-53197775 CTGGAGAAGTAGCAGGAAAGAGG - Intergenic
990675444 5:58179048-58179070 CAGGAGAAGTAGAGAGAGAAGGG + Intergenic
990708654 5:58558374-58558396 CTTGATCAGAAGAAGGAGGAAGG - Intergenic
991166477 5:63569360-63569382 CTAGAACAGGAGAAGGGGAAGGG - Intergenic
991247598 5:64524771-64524793 CTGAAGCAGGAGAGGGAGAGAGG - Intronic
991974936 5:72176341-72176363 GTGGATCAGGAAAAGGAGAAAGG + Intronic
992843093 5:80715727-80715749 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
993066512 5:83105382-83105404 CTGGGGCAGAGGAAGGAGATTGG + Intronic
993070416 5:83155070-83155092 CTGGGGCAGGAGAAAGAGGAAGG + Intronic
993215534 5:85018254-85018276 CAGGAGGAGGAGAAAGAGAAGGG + Intergenic
993219520 5:85073060-85073082 GTGGAGCAGTAGATGTAGAAGGG - Intergenic
993514191 5:88809912-88809934 CTGGAGGACTACAATGAGAAAGG - Intronic
994002988 5:94803392-94803414 GTGGTACAGTAGAAAGAGAACGG + Intronic
994714665 5:103307098-103307120 GTGGAGAAGGAGAAGAAGAAGGG + Intergenic
995173036 5:109139453-109139475 AAGGAGAAGTAGCAGGAGAATGG - Intronic
995322601 5:110853747-110853769 ATGGAGAAGAAGAAGGAGACAGG + Intergenic
995544454 5:113216000-113216022 CTGGAACAGGGAAAGGAGAAGGG - Intronic
995946689 5:117656185-117656207 CTGGAGGAGTCTAAGGAGACAGG + Intergenic
996232966 5:121088501-121088523 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
996674586 5:126159232-126159254 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
996849679 5:127938084-127938106 CAGGAGTAGGAGAAGGAAAATGG - Intergenic
996911010 5:128656571-128656593 CTGGAGCAGGAGGAAGAGCAAGG + Intronic
997377598 5:133408473-133408495 CTGGTGGAGCAGAGGGAGAAGGG + Intronic
997462978 5:134067624-134067646 AAGGAGGAGGAGAAGGAGAAGGG + Intergenic
998957607 5:147453618-147453640 CCGGAGCAGAAGAAGGAGGGAGG - Intronic
999379259 5:151108831-151108853 CTGGGGTAGTAAAAGGAGCACGG + Intronic
1000579437 5:163017136-163017158 CTGGAGCAAGAGAACGAGAAAGG - Intergenic
1000747655 5:165055053-165055075 GAGGAGGAGTAGAAGGAGGAAGG - Intergenic
1001839553 5:174863601-174863623 TTGGAGTACTAGAAGGAGACAGG - Intergenic
1002019729 5:176355510-176355532 CTGGAGCAGAGGAAGGACAAAGG + Intronic
1002250135 5:177923687-177923709 CTGAGGCAGTAGGAGGGGAAGGG + Intergenic
1003127347 6:3365823-3365845 CAGCAGCAGCAGAAGGAAAAAGG + Intronic
1003402685 6:5803949-5803971 CAGGAACAGTAGAAGTAGGAAGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1003766562 6:9243485-9243507 CTGGGGCTGGCGAAGGAGAAGGG + Intergenic
1003818056 6:9863759-9863781 CTGGAGCAGGAGGAAGAGAGTGG + Intronic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1004071288 6:12300306-12300328 CTGGAGGAGTTTAAGAAGAAAGG - Intergenic
1004402258 6:15299656-15299678 CTGGTGCAGTGGCTGGAGAAAGG - Intronic
1004523559 6:16384712-16384734 CTGGAGCAGGAGGAAGGGAAAGG - Intronic
1004701411 6:18082949-18082971 CTGGAGAAAAAGAAGGAAAAAGG - Intergenic
1004834198 6:19512523-19512545 GAGGAGGAGTAGGAGGAGAAGGG - Intergenic
1005211641 6:23472245-23472267 CAGGTGAAGTAGAAGGAGTATGG + Intergenic
1005384956 6:25277191-25277213 TTGCAGCAGTAGCAGTAGAAGGG + Intergenic
1006578786 6:35064683-35064705 CTGGGGCAGAAGAAGGCAAAAGG - Intronic
1006652437 6:35562814-35562836 CTGGAGAAGGAGAAAGGGAAGGG + Intergenic
1007221598 6:40283140-40283162 CTGCAGCAGTAGAAGCATTAGGG + Intergenic
1008302503 6:49858714-49858736 TTTGAGCATTAGAAAGAGAAAGG - Intronic
1008311341 6:49978381-49978403 CTGGAGCAGGGCAAGGATAAAGG + Intergenic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1011016593 6:82763228-82763250 CAGGAGCAGTAGGTGGAGGAAGG + Intergenic
1011180665 6:84616414-84616436 CTGGAGGAGTGGAAGGACAGAGG + Intergenic
1012079523 6:94737377-94737399 CTGGGGTCTTAGAAGGAGAAAGG - Intergenic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012674780 6:102101686-102101708 CTAGAGCAGGAGAAAGAGAGAGG + Intergenic
1013547785 6:111176168-111176190 GTGGATTAGTAGAGGGAGAAGGG + Intronic
1013829900 6:114258656-114258678 CAAGAGCAGGACAAGGAGAAGGG - Intronic
1014701936 6:124699621-124699643 CTGGAGCAGCAGCAAGAGAGTGG - Intronic
1014986850 6:128021778-128021800 CTGGAGTTTTAGAAGGAGCAAGG + Intronic
1015010105 6:128335494-128335516 CTCAAGTAGTAGAAGGAAAAAGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015292987 6:131559664-131559686 CTGAGGCAGGAGAATGAGAATGG - Intergenic
1015804411 6:137093861-137093883 CTGGAGCAGCAGCAAGAGAGAGG + Intergenic
1015883576 6:137893329-137893351 CTAGAGCAGCAGAAGGGGAGGGG - Intergenic
1016560667 6:145392419-145392441 AAGGAGCAGTAGAAGGAGAATGG - Intergenic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017530740 6:155289901-155289923 CTGGAGCAGTAGGAAGAGAGTGG - Intronic
1017590972 6:155977633-155977655 CTGAAACAGTAGAGGAAGAAAGG + Intergenic
1017949127 6:159120892-159120914 CTGAAGCAATAGCAGGAGGAAGG - Intergenic
1017994888 6:159523365-159523387 GTGGAGGAGTAGGAGAAGAAGGG - Intergenic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1018632335 6:165831904-165831926 CTGGAGGAGTAGAAGACGTAAGG - Intronic
1018946717 6:168352400-168352422 CTGGAGCAGGAGAAAGAGGTGGG + Intergenic
1019006850 6:168805358-168805380 CAGGTGCAGTAGAAATAGAACGG + Intergenic
1019113373 6:169736930-169736952 TTGGAGTAGCAGAAGGAGATGGG - Intergenic
1019701364 7:2476337-2476359 CTGGACCTGGAGAAGGAGAACGG - Intronic
1019816364 7:3204039-3204061 CTGGAGCAGGAGGAGGAGAGAGG + Intergenic
1019969601 7:4529567-4529589 CAGGAGCAGGAGCAAGAGAAAGG + Intergenic
1021414990 7:20373717-20373739 CTTCAGCAGGGGAAGGAGAAGGG - Intronic
1022389551 7:29931563-29931585 CTGCAGCAGTATAAGGTGTATGG - Intronic
1022803629 7:33799650-33799672 CTGGAGCAATGGGAGTAGAAAGG - Intergenic
1022873493 7:34503998-34504020 CTGGAGCAGGAGCAAGAGGAGGG + Intergenic
1022990710 7:35704522-35704544 ATGGAACAGTGGAAGGAGAAGGG - Intergenic
1023057713 7:36303174-36303196 CTAGGGCTGTACAAGGAGAAAGG + Intergenic
1023750519 7:43367950-43367972 CTGGAGAGGTGGAAGCAGAAGGG - Intronic
1024264874 7:47598796-47598818 CTGAAGCTGTAGAAGGAGGCAGG - Intergenic
1024438921 7:49392070-49392092 CTCTAGCACAAGAAGGAGAAGGG + Intergenic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024724773 7:52180130-52180152 CTGGAGCAGTAGGTGGAGGGCGG + Intergenic
1024929044 7:54650565-54650587 CAGGAGCAGAAAGAGGAGAAAGG - Intergenic
1024939387 7:54746347-54746369 CTGGAACAGCATAAGGGGAAAGG - Intergenic
1026216146 7:68350876-68350898 TTGGATCAGTAGAAGGAGAGAGG + Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1027970825 7:85078846-85078868 CTAGAGAGGAAGAAGGAGAAAGG + Intronic
1028167607 7:87556606-87556628 CTGGAGCAGAGGCAGGAGAGGGG - Intronic
1028372098 7:90103957-90103979 CTGGACTTGAAGAAGGAGAAAGG - Intergenic
1028519931 7:91718626-91718648 CTGAAGAAGAAGAAGGATAATGG - Intronic
1029403395 7:100358779-100358801 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029405973 7:100374133-100374155 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1030434697 7:109502015-109502037 CTCTAGCAGGAGAAGGAGATAGG + Intergenic
1030583075 7:111384174-111384196 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
1031080842 7:117255572-117255594 CTGGAGGAGGAGAAAGAGAGGGG - Intergenic
1031796204 7:126176992-126177014 GAGGAGGAGGAGAAGGAGAAGGG - Intergenic
1031974551 7:128085493-128085515 TGGGAGCAGAAGAGGGAGAAAGG - Intronic
1032488453 7:132305975-132305997 CTGGAACTGTAGATGGAGAGGGG + Intronic
1032606283 7:133357862-133357884 CTGTGGCAGGAGAAGGATAAAGG - Intronic
1033245052 7:139710869-139710891 CTGGAGAAGGAGAAAGAGAGAGG - Intronic
1033385926 7:140874930-140874952 CTGGAGCAGAAGCAAGAGATGGG - Intronic
1034446492 7:151116511-151116533 CTGGAGCAGGAAGAGGAGGAAGG + Intronic
1035057537 7:156046097-156046119 CAGGAGCAGGAGCAGGAGAGAGG + Intergenic
1035109706 7:156470927-156470949 CGGGAGCAGGAGCAGGAGAGCGG - Intergenic
1035850990 8:2919167-2919189 ATGCTGCAGGAGAAGGAGAAAGG - Intergenic
1035979352 8:4352073-4352095 TTCCAGCAGTAGAAGGAGAGTGG - Intronic
1036295217 8:7529242-7529264 CTGGAGAAGGAGGAGGAGAAGGG - Intergenic
1036327353 8:7791776-7791798 CTGGAGAAGGAGGAGGAGAAGGG + Intergenic
1036390319 8:8318956-8318978 CTGGAGCACCTGAAGGAGCACGG - Exonic
1036495038 8:9262635-9262657 CTGAGGCAGGAGCAGGAGAATGG - Intergenic
1037019091 8:13945921-13945943 CTGTAGCCATAGAAGGAGACAGG - Intergenic
1037071102 8:14650223-14650245 ATGGATCAGGAGTAGGAGAAAGG + Intronic
1037655440 8:20879695-20879717 GAGGAGGAGGAGAAGGAGAAAGG + Intergenic
1037924781 8:22835575-22835597 CTGGAGCACTGGAAGGAATAGGG + Intronic
1038857290 8:31347732-31347754 CTGGAGCAGAAGATAGAGAGAGG - Intergenic
1038974721 8:32681433-32681455 AAGGTGCAGAAGAAGGAGAAGGG - Intronic
1039839549 8:41284198-41284220 ATGGAAGAGGAGAAGGAGAACGG + Intronic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1040767548 8:50931941-50931963 CTGGAGCAGGAGCAAGAAAATGG - Intergenic
1041180214 8:55239536-55239558 GTGGGGCAGCAGAAGGAGAGTGG - Intronic
1041216448 8:55606349-55606371 CTGGAGAAGGAGGAGGAGAGAGG - Intergenic
1041741361 8:61160483-61160505 CTGCAGGAGCAGAAGGAAAATGG + Intronic
1041861870 8:62523616-62523638 TAGGAGCAGGAGAAGGAAAATGG + Intronic
1042299619 8:67263089-67263111 TGGGAGCAGAGGAAGGAGAAGGG - Intronic
1042677931 8:71343281-71343303 CTAAATCAGTTGAAGGAGAAGGG - Intronic
1043284639 8:78514310-78514332 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1043385585 8:79744628-79744650 AAGGAGAAGTAAAAGGAGAAGGG + Intergenic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1044250453 8:89999682-89999704 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
1044465121 8:92493537-92493559 CTGGAGGAGAAGAAAGACAATGG + Intergenic
1046351530 8:113020809-113020831 GGGGAACAGTAGAAGGAGGATGG + Intronic
1046376785 8:113393604-113393626 CTGGAGAAGGAAAATGAGAAAGG + Intronic
1046412653 8:113867375-113867397 AAGGAGGAGGAGAAGGAGAAAGG - Intergenic
1046480994 8:114818317-114818339 CTGCAGCTGAAGCAGGAGAATGG + Intergenic
1046632727 8:116637484-116637506 CTGGAGTAGGAGAGAGAGAAAGG - Intergenic
1046678249 8:117137108-117137130 CAGGAGATGTAGACGGAGAAGGG - Intronic
1047250088 8:123175411-123175433 GAGGAGGAGGAGAAGGAGAAAGG - Intergenic
1047552371 8:125888996-125889018 CTGGAACAGAAGAAGGATATAGG - Intergenic
1048043007 8:130748960-130748982 CTGGGGCAAGAGAGGGAGAAGGG + Intergenic
1048417556 8:134243627-134243649 AAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1048417573 8:134243687-134243709 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1048705442 8:137148091-137148113 CTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1049010674 8:139884937-139884959 CTGGTGGAGTGCAAGGAGAAAGG + Intronic
1049548131 8:143244123-143244145 CAAAAGCAGAAGAAGGAGAAAGG - Intergenic
1050427330 9:5524930-5524952 CTGGGGCTGTACAAGGAGCAAGG - Intronic
1051040728 9:12807159-12807181 CGGGAGCTGAAGCAGGAGAATGG + Intronic
1051672738 9:19528495-19528517 CTGGAGCAAAAGAAAGAAAAAGG - Intronic
1052069682 9:24067082-24067104 CTGGAACTGGAGAGGGAGAAAGG + Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052389559 9:27863203-27863225 CTTAAGCAGTAGATGGAGTAAGG - Intergenic
1052738435 9:32369648-32369670 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1053616995 9:39778081-39778103 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1053730914 9:41056107-41056129 CTGGAACAGAAGAAGGAGGGCGG - Intergenic
1053875176 9:42537430-42537452 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1054236521 9:62564298-62564320 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054267172 9:62929356-62929378 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054550661 9:66598801-66598823 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054697599 9:68375983-68376005 CTGGAACAGAAGAAGGAGGGCGG + Intronic
1054797791 9:69318650-69318672 CCAGAGCAGGAGAAAGAGAAGGG + Intergenic
1054832869 9:69645662-69645684 CTTCAGCAGTGGCAGGAGAAGGG + Intronic
1055295177 9:74826619-74826641 CTGGAGGAGGGCAAGGAGAAGGG - Intronic
1056847971 9:90056842-90056864 CTGGAGTGGGAGGAGGAGAATGG + Intergenic
1057577755 9:96257011-96257033 CTGGAGCAGCAGGAAGAGAAGGG - Intronic
1058374463 9:104306439-104306461 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1058679760 9:107430686-107430708 CTGGATCAAGAGGAGGAGAAAGG + Intergenic
1058853601 9:109037584-109037606 CTGGAGCAGGAGGAAGAGAGGGG - Intronic
1059458800 9:114416534-114416556 CTGGAGGAGGAGGAAGAGAAGGG - Intronic
1059693802 9:116711730-116711752 ATGGGACAGTAGAAGGTGAAAGG - Intronic
1060369895 9:123058877-123058899 CTGGAGCATTACAAAGAGAAAGG - Intronic
1060625848 9:125110618-125110640 CTGGAGCAGGAGCAAGAGAGTGG - Intronic
1060677062 9:125524869-125524891 CTGGAGCAGGATATGCAGAAGGG - Intronic
1060785419 9:126448673-126448695 CGGGAGCAAGAGAAAGAGAAGGG + Intronic
1061099923 9:128484758-128484780 CTGAAGGAGTTGAAGCAGAAGGG + Exonic
1062212929 9:135374209-135374231 CTGGAGCAGGAGAAACAGATTGG - Intergenic
1185513660 X:681852-681874 CAAGAGAGGTAGAAGGAGAAAGG + Intergenic
1185591635 X:1281152-1281174 AAGGAGGAGTAGGAGGAGAAGGG - Intronic
1185688323 X:1948429-1948451 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1185688601 X:2133951-2133973 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1185871540 X:3668819-3668841 CTGGGGCAGAAAAGGGAGAAAGG + Intronic
1186471166 X:9823100-9823122 AGGGAGAAGGAGAAGGAGAAGGG - Intronic
1186568434 X:10689316-10689338 TTGGAGCAGGAGAAAGAGAGAGG + Intronic
1186578731 X:10793969-10793991 AGGGAGCAAGAGAAGGAGAAAGG - Intronic
1186908744 X:14139037-14139059 AAGGAGGAGAAGAAGGAGAAGGG + Intergenic
1188473905 X:30569630-30569652 CTGGAACAGTACAAGGAGGAAGG + Intronic
1188486463 X:30687510-30687532 CTGGAGCATTAGAAGAAATAAGG - Intronic
1188562944 X:31490449-31490471 CTGAGGCAGGAGAAGGAGAATGG + Intronic
1190407865 X:50105465-50105487 CTGGTGTAGTAGAAAGAGCATGG + Intergenic
1190446074 X:50525783-50525805 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
1190747434 X:53332806-53332828 CTGGAGCAGAAGGTGAAGAAAGG - Intergenic
1192603183 X:72486382-72486404 GTGGAGCAGTAGAGGGAAAGGGG - Intronic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1194596872 X:95869144-95869166 TTGGAGTAGTAGGAGGAGATGGG + Intergenic
1195086283 X:101417470-101417492 CTGGAGCAGGGGAAGGCAAAGGG - Intergenic
1197440112 X:126477130-126477152 CTGGAGAAAGAGAAGGTGAAGGG + Intergenic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1199049576 X:143221366-143221388 CTGGAGCAGGAGGAAGAGATGGG - Intergenic
1199117251 X:144007724-144007746 CTGGAACAGGAGGAAGAGAAAGG + Intergenic
1199263974 X:145808734-145808756 CAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1199684971 X:150257643-150257665 CTGGAGAACAAGATGGAGAAGGG - Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200709671 Y:6472242-6472264 CTGGAGCATGAGAAGGAGGCCGG - Intergenic
1201024441 Y:9692466-9692488 CTGGAGCATGAGAAGGAGGCCGG + Intergenic
1201300273 Y:12498833-12498855 CAGGAGGAGGAGGAGGAGAAGGG - Intergenic