ID: 1081561579

View in Genome Browser
Species Human (GRCh38)
Location 11:44221842-44221864
Sequence CGTGAGTTTCAGGCAGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081561574_1081561579 14 Left 1081561574 11:44221805-44221827 CCCATTCATTGCAAAATTGTACA 0: 1
1: 0
2: 2
3: 18
4: 228
Right 1081561579 11:44221842-44221864 CGTGAGTTTCAGGCAGTGGTTGG 0: 1
1: 0
2: 0
3: 11
4: 133
1081561575_1081561579 13 Left 1081561575 11:44221806-44221828 CCATTCATTGCAAAATTGTACAA 0: 1
1: 0
2: 1
3: 35
4: 294
Right 1081561579 11:44221842-44221864 CGTGAGTTTCAGGCAGTGGTTGG 0: 1
1: 0
2: 0
3: 11
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081561579 Original CRISPR CGTGAGTTTCAGGCAGTGGT TGG Intronic
902241918 1:15095187-15095209 CGTGAGGTTCCCGCATTGGTTGG - Intronic
904971275 1:34421182-34421204 CCAGAGTTTCAAGCAGTGTTTGG + Intergenic
906549855 1:46655373-46655395 CGTTAGTGTCAAGCAGAGGTAGG - Intronic
906936170 1:50215677-50215699 TGTGAGCTTCAGGCAGTTTTAGG - Intergenic
908041844 1:60122264-60122286 CGTGAGTTTAAGACATGGGTTGG - Intergenic
909484745 1:76160215-76160237 CAAGAGTGGCAGGCAGTGGTTGG + Intronic
913107455 1:115627798-115627820 ATTGAGTTTCAGGCAAGGGTAGG - Intergenic
913265035 1:117035408-117035430 CATGAGTTTAAGGAACTGGTAGG - Intronic
915118838 1:153616175-153616197 TGTGTGTTTCAAGCAGAGGTGGG - Intronic
915946236 1:160153917-160153939 CGGGTGTTTCAGGCAGAGGTTGG + Intronic
915955876 1:160219495-160219517 GCTGAGTTGCAGGGAGTGGTGGG + Intronic
920118581 1:203638601-203638623 GGTTAGTTTGAGGCAGAGGTGGG + Intronic
921163153 1:212487110-212487132 CAGGAGTTTCAGGCTGTAGTGGG - Intergenic
1065347845 10:24765765-24765787 ACTGAGTGTCAGGCAGAGGTTGG - Intergenic
1073124628 10:101141647-101141669 GGTGAGTTCCAGGGAGTGATGGG + Intergenic
1077204860 11:1337254-1337276 CGGGAGTGCCAGGCGGTGGTGGG - Intergenic
1078648340 11:13163616-13163638 AGGGAGTTCCAGGCAGTGGCAGG - Intergenic
1078721048 11:13883436-13883458 CGTAAGTGGCAGGCACTGGTGGG + Intergenic
1079806051 11:24932326-24932348 CGGGTGTCTCAGGCAGTGGGTGG + Intronic
1080204998 11:29717990-29718012 CCTGAGTAACAGGCAGAGGTTGG - Intergenic
1080648874 11:34207131-34207153 CGTGGGTTTCAGCCTGTAGTTGG - Intronic
1080702178 11:34653249-34653271 CCTGAGGCTCAGGAAGTGGTTGG - Intronic
1081561579 11:44221842-44221864 CGTGAGTTTCAGGCAGTGGTTGG + Intronic
1088180388 11:107103178-107103200 CTGGTGTTTCAGGCAGTGGGAGG - Intergenic
1094295174 12:28897702-28897724 ACTGAGTATCAGGCAGAGGTTGG + Intergenic
1097310994 12:58118636-58118658 CAGGAGTTCCAGGCTGTGGTTGG + Intergenic
1099956619 12:89357299-89357321 CATGACTTACAGGCAGTGATAGG + Intergenic
1100675000 12:96856785-96856807 AGTGAGTAACAGGCAGAGGTTGG - Intronic
1100931384 12:99613897-99613919 GTTGAGTTTCAGGCATTGGCAGG - Intronic
1101597328 12:106178593-106178615 GAGGAATTTCAGGCAGTGGTTGG + Intergenic
1103606021 12:122086796-122086818 CCTGGGTTCCAGGCAGTGCTAGG + Intronic
1107999158 13:45890572-45890594 CGGGATTTCCAGGCAGGGGTAGG + Intergenic
1110123443 13:71911779-71911801 GCTGAGTTTAAGACAGTGGTGGG - Intergenic
1114081266 14:19202958-19202980 AGTGAGTAACAGGCAGAGGTTGG + Intergenic
1114255641 14:20999322-20999344 CGTGAGTTTCAGGAGGCTGTTGG - Exonic
1116141314 14:40998396-40998418 AGTGAATTTCAGACAGCGGTAGG - Intergenic
1117009513 14:51455973-51455995 TGTTATTTTCAGGCAGTGGGTGG + Intergenic
1118657591 14:67968779-67968801 AGTCAGTATCAGGCAGAGGTTGG - Intronic
1122488272 14:102095982-102096004 TGTGTGTTGCAGGCAGAGGTGGG - Intronic
1122619785 14:103049089-103049111 AATGTGTTTCAGGCAGTGGAGGG + Intronic
1123163682 14:106305028-106305050 CCTAAGTTCCAGGCAGTGGTAGG + Intergenic
1124368764 15:29091443-29091465 CAGGAGTTTGAGGCAGTGGAGGG + Intronic
1125130701 15:36280788-36280810 CGGGAGTTTGAGGCTGTGGCAGG - Intergenic
1135183886 16:20298244-20298266 GGCGTGTTTCAGGCAGAGGTGGG + Intergenic
1144137748 17:12314566-12314588 AGTGGGTCTCAGGCAGGGGTAGG + Intergenic
1144276942 17:13679432-13679454 CCAGAGTTTTAGGCAATGGTGGG - Intergenic
1144944416 17:18962451-18962473 AGTGAGTAATAGGCAGTGGTGGG + Intronic
1149654382 17:58302587-58302609 TGTGTGTTTCTGACAGTGGTGGG - Intronic
1149855262 17:60077467-60077489 AGTGAGATTAAGGCAGTAGTCGG - Intronic
1151152626 17:72100933-72100955 CTTGCGTTTCAGGCAGCGATTGG + Intergenic
1151800294 17:76375456-76375478 GGTGAGTTTCAGGCACTGCTAGG + Intronic
1153361047 18:4197445-4197467 TGTGAGTGTCTGGCAGTGTTAGG + Intronic
1153676509 18:7460337-7460359 CCTGATTTACATGCAGTGGTGGG - Intergenic
1154499158 18:14986250-14986272 AGTGAGTAACAGGCAGAGGTTGG - Intergenic
1155497142 18:26453843-26453865 CCTGTGTTTCAGGCAGTGATAGG + Intergenic
1157357212 18:46946883-46946905 CGTGAATTTCAGGGTCTGGTAGG - Exonic
1161000496 19:1908296-1908318 CGTGAGCTTCGGGCAGCGCTGGG + Intronic
1161363371 19:3864036-3864058 GGAGAGTTTCAGGAAGTGGGAGG - Intronic
1161927610 19:7312910-7312932 GGTGTGTCTCAGGCAGGGGTGGG - Intergenic
1162327180 19:10006249-10006271 CGGGGGTGTCAGGCAGAGGTGGG + Intronic
1162760290 19:12884972-12884994 CGTGTGTTTCCGGTAGTGGCGGG + Exonic
1164729911 19:30495753-30495775 ATTCAGTGTCAGGCAGTGGTTGG + Intronic
1167647534 19:50713798-50713820 CGTGAGTGCCAGGCAGTGTCGGG + Exonic
925208574 2:2027336-2027358 CCTGAGTTTAAGCCTGTGGTGGG - Intronic
925642166 2:5996075-5996097 CTTGAGCTCCAGGCACTGGTGGG - Intergenic
926734052 2:16058980-16059002 CTTCATTTTCAGGCAGTGGAAGG - Intergenic
926783475 2:16497423-16497445 CCTGAGTCTCAGGTTGTGGTTGG - Intergenic
926951949 2:18252685-18252707 CTTGATTTTCAGGCAGTTCTGGG + Intronic
934477615 2:94603771-94603793 CGTGTGTTCCTGGCAGTGCTGGG - Exonic
935587644 2:104816107-104816129 CATGAGGTCCAGGCAGTGGGAGG + Intergenic
937613776 2:123895076-123895098 TGGGAGTTTCAGGCATTGTTGGG + Intergenic
938240519 2:129739258-129739280 ACTGAGTTTGAAGCAGTGGTGGG - Intergenic
938498362 2:131816531-131816553 AGTGAGTAACAGGCAGAGGTTGG - Intergenic
940327516 2:152441460-152441482 CGTGAGTTTGAGGCTGCAGTAGG + Intronic
943386605 2:187209830-187209852 AGTGGGTTACAGGCAGAGGTTGG + Intergenic
943563912 2:189495415-189495437 CTTGAGTAACAGGCAGAGGTTGG + Intergenic
945643436 2:212460334-212460356 ACTGAGTTACAGGCAGAGGTTGG + Intronic
945663782 2:212717460-212717482 CTGGAGATTGAGGCAGTGGTTGG + Intergenic
945893143 2:215451763-215451785 CTTGAGTTTTAGGCAGTCTTCGG - Intergenic
946525971 2:220520767-220520789 AGTGAGTTTCAGGGAGGGGAAGG + Intergenic
948903637 2:240967886-240967908 CGTGAGTGTGAGGCAGTGGGGGG - Intronic
1175725271 20:61313808-61313830 CATGAGTTTGAGGCTGTAGTGGG - Intronic
1178415696 21:32403368-32403390 CTGGAGCTTCAGGCAGTTGTGGG - Intergenic
1180499505 22:15919728-15919750 AGTGAGTAACAGGCAGAGGTTGG - Intergenic
1184533847 22:45073101-45073123 GGAGAGTTTCTGGGAGTGGTGGG - Intergenic
949278064 3:2310754-2310776 AGTGAGTTTTAGGTAGTGGAGGG - Intronic
950125925 3:10509766-10509788 AGGGAGTTTCAGGCCTTGGTGGG - Intronic
954454754 3:50591732-50591754 CATGACTTGGAGGCAGTGGTTGG - Intergenic
956140356 3:66140335-66140357 CCTGAGTTTAGGGCAGGGGTTGG + Intronic
963052530 3:141154156-141154178 CCTGAGTTTCAGCCAGTGGGAGG - Intergenic
963749726 3:149164106-149164128 CATCAGTTTCAGGCAGAGGCAGG - Intronic
964369126 3:155981211-155981233 TGTGAGTTTGTGGCAGGGGTCGG + Intergenic
967020893 3:185521499-185521521 CTTGAGTTTTTGGCAGTTGTTGG - Intronic
968486665 4:866264-866286 TGTGGGTCTCAGGCAGTGGTGGG - Intronic
971300779 4:25440918-25440940 CCTGAGTGTCAGGCAGAGGTGGG - Intergenic
971532770 4:27709867-27709889 TGTTAGTTTTAGGCAGTGGTTGG + Intergenic
980784955 4:137541104-137541126 AGTGATTTTTAGGCAGAGGTGGG + Intergenic
982915537 4:161203978-161204000 CCTGGGTTTCAAGCAGTGGGTGG + Intergenic
986311664 5:6555799-6555821 CAGGAGTTTGAGGCTGTGGTGGG - Intergenic
987189790 5:15464363-15464385 CAGGAGTTTAAGGCAGTTGTAGG - Intergenic
988147575 5:27330273-27330295 CCTGAGTAACAGGCAGAGGTTGG + Intergenic
991772721 5:70054495-70054517 TGGAAGTTTCAGGAAGTGGTAGG + Intronic
991852014 5:70929919-70929941 TGGAAGTTTCAGGAAGTGGTAGG + Intronic
994542902 5:101122258-101122280 ACTGGGTTTCAGGCAGAGGTTGG - Intergenic
995240314 5:109877987-109878009 CGTGTGTTTCAGCGTGTGGTAGG - Intergenic
1000630661 5:163587083-163587105 CCTGAGTTCCAAGCAGGGGTGGG + Intergenic
1000786783 5:165554755-165554777 AGTGAGTTTCATGAAGTGATAGG + Intergenic
1001973681 5:175979035-175979057 TGTGAGTTTCAGGCTGTTTTGGG - Intronic
1002243751 5:177864744-177864766 TGTGAGTTTCAGGCTGTTTTGGG + Intergenic
1005972881 6:30775313-30775335 CTGGAGTTCCAGTCAGTGGTGGG - Intergenic
1006055695 6:31383004-31383026 ATTCAGTTTCAGGCAGTTGTGGG + Intergenic
1006067199 6:31470637-31470659 CATGAGATTCAGGCAGAGGGAGG + Intergenic
1006089472 6:31620136-31620158 CGTGAGTTTGAGGAGGTGGTTGG - Intergenic
1007210242 6:40187913-40187935 CCTGAGTCTCTGGCAGGGGTAGG - Intergenic
1009532778 6:64842470-64842492 ACTGACTTTCAGGCAGAGGTTGG + Intronic
1017039398 6:150295608-150295630 CGTGCGTTTCAGCCAGTGGGAGG - Intergenic
1018134847 6:160769232-160769254 TGTGTGTTTGGGGCAGTGGTAGG - Intergenic
1018590594 6:165417199-165417221 CATGAGTTTTATGCAGTGTTTGG - Intronic
1019101487 6:169634327-169634349 CGTGAGTGTCAGGCATTGTGTGG - Intronic
1020443955 7:8248709-8248731 CGAGAGGTTGAGGGAGTGGTGGG - Intronic
1048147945 8:131863859-131863881 GGTGAGTTGCAGGCTTTGGTTGG + Intergenic
1053680448 9:40482336-40482358 CGTGTGTTCCTGGCAGTGCTGGG + Intergenic
1053930436 9:43110647-43110669 CGTGTGTTCCTGGCAGTGCTGGG + Intergenic
1054283264 9:63142599-63142621 CGTGTGTTCCTGGCAGTGCTGGG - Intergenic
1054293533 9:63317851-63317873 CGTGTGTTCCTGGCAGTGCTGGG + Intergenic
1054391555 9:64622340-64622362 CGTGTGTTCCTGGCAGTGCTGGG + Intergenic
1054504173 9:65893988-65894010 CGTGTGTTCCTGGCAGTGCTGGG - Exonic
1054912702 9:70468455-70468477 AGTGAATTTCAGGCAGAGGAAGG - Intergenic
1056006683 9:82279330-82279352 CTTGACTTTTAGGCAGTTGTAGG - Intergenic
1057435622 9:95037901-95037923 CCTGAGTGTCATGCCGTGGTGGG + Intronic
1057514734 9:95711629-95711651 CATGAGTGGCAGGCAGTGGCTGG - Intergenic
1058751643 9:108044720-108044742 TGTGAGTTCCTGGCACTGGTGGG - Intergenic
1059912188 9:119056784-119056806 TTTGAGTTCCAGGGAGTGGTAGG - Intergenic
1061005834 9:127928043-127928065 CGTGAGCTTGCGGCAGGGGTGGG - Exonic
1061023953 9:128035294-128035316 CCTGAGTTTCAGGCTCTGGGTGG - Intergenic
1061265200 9:129500726-129500748 CCTGAATTTCAGGCCGTGGGAGG - Intergenic
1062123157 9:134845077-134845099 AGTGAGTTTCAGCCACTGCTGGG + Intergenic
1062295915 9:135826464-135826486 CTTGTGATACAGGCAGTGGTGGG - Intronic
1062624256 9:137435785-137435807 GGTGAGGTTCAGGAAGTGGAAGG + Exonic
1186102068 X:6167806-6167828 CTTGAGTTTCAGGAAGGGGGAGG - Intronic
1186477615 X:9870150-9870172 CGGGAGGTGCAGGCTGTGGTGGG + Intronic
1192244124 X:69359073-69359095 AGTGGGTTATAGGCAGTGGTTGG - Intergenic
1194534353 X:95086888-95086910 AGTGAGTAACAGGCAGAGGTTGG - Intergenic
1197069483 X:122278929-122278951 TGTGAGTTGGTGGCAGTGGTGGG + Intergenic
1200688054 Y:6274707-6274729 GGTGAGTTTCTGACAGTGTTAGG - Intergenic