ID: 1081561953

View in Genome Browser
Species Human (GRCh38)
Location 11:44225927-44225949
Sequence TATTATCCACAGAAGGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081561951_1081561953 -5 Left 1081561951 11:44225909-44225931 CCAAAGTGTGAGTCTTCTTATTA 0: 1
1: 0
2: 0
3: 16
4: 224
Right 1081561953 11:44225927-44225949 TATTATCCACAGAAGGCTCATGG 0: 1
1: 0
2: 0
3: 15
4: 136
1081561950_1081561953 2 Left 1081561950 11:44225902-44225924 CCAACTGCCAAAGTGTGAGTCTT 0: 1
1: 0
2: 1
3: 16
4: 162
Right 1081561953 11:44225927-44225949 TATTATCCACAGAAGGCTCATGG 0: 1
1: 0
2: 0
3: 15
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081561953 Original CRISPR TATTATCCACAGAAGGCTCA TGG Intronic
900410851 1:2511988-2512010 TGCGATCCGCAGAAGGCTCAGGG + Intronic
902285143 1:15403431-15403453 TCAAATCCACAGAAGGGTCATGG - Intergenic
903921236 1:26802679-26802701 TATTATCCAAGGTAGGCTAACGG + Intergenic
905277387 1:36827309-36827331 AAATATCCACAGAAGCCCCAGGG - Intronic
905698737 1:39995859-39995881 TATTATCCCCAGCAGGCCTAAGG + Intergenic
908462829 1:64362656-64362678 TATAATTCACAGAATTCTCAAGG - Intergenic
910233927 1:85014998-85015020 TATTATCCATTGAATGCCCATGG + Intronic
911571086 1:99517683-99517705 CATCATCCAAAGAAGGATCATGG - Intergenic
912114276 1:106385205-106385227 TATTAACCTCATAAAGCTCAGGG - Intergenic
915475244 1:156149389-156149411 TGTTAGCCACAGAAGGCTTCTGG + Intronic
916521557 1:165568033-165568055 GTTTCTCCAAAGAAGGCTCATGG + Intergenic
918014009 1:180615278-180615300 TATTATCCTCAAAAGGCTTCCGG - Intergenic
920925204 1:210334589-210334611 TATTACCCACAGAAGGAGCAGGG - Intronic
1065942050 10:30573769-30573791 TATTATCCAAATAAGGTTTAGGG + Intergenic
1067146504 10:43697901-43697923 TATTATACACGGAAAGCACAAGG - Intergenic
1069164921 10:65142931-65142953 TGTTATCCTCAGGTGGCTCATGG - Intergenic
1070267317 10:74916542-74916564 TATTACCCAGAGAATGCTTATGG + Intronic
1070496988 10:77033699-77033721 AATTCTCTACAGAAGGGTCAGGG - Intronic
1072603461 10:96955183-96955205 TATTATCCAGGGAAGCCTCTTGG + Exonic
1072700156 10:97634719-97634741 TATTATGCAGAGAAGGCTACAGG + Intronic
1073154028 10:101332359-101332381 CATTATCCACTGAAGGCTAAAGG - Intergenic
1074725994 10:116310577-116310599 TATTTTTCAAAGAAGGCTTAAGG - Intergenic
1077779914 11:5316231-5316253 TTTTCTCCACAGAGGGCTCATGG - Intronic
1078417960 11:11181007-11181029 TATTAAACACAGAACGCTAAAGG + Intergenic
1081142468 11:39518863-39518885 TATTTTTCACAGAAGCCTTAGGG + Intergenic
1081561953 11:44225927-44225949 TATTATCCACAGAAGGCTCATGG + Intronic
1082269870 11:50158684-50158706 TATAGTCCACTGAAGGCACAGGG + Intergenic
1082665259 11:55968241-55968263 CATTATCCCAAGAATGCTCATGG - Exonic
1084685804 11:70694529-70694551 AATTATCCACAGTAGGCTGTGGG - Intronic
1085394634 11:76201104-76201126 CATCCTCCCCAGAAGGCTCAGGG + Intronic
1087117418 11:94540699-94540721 TATTTTCCACTGAAAGCTTAAGG + Intergenic
1087866190 11:103229154-103229176 CTTTCTCAACAGAAGGCTCATGG - Intronic
1092335007 12:7624620-7624642 TATTATTTTCAGAAGGCTCTGGG + Intergenic
1092559448 12:9595528-9595550 TATTAAACAAAGAAGGCACACGG + Intronic
1094120526 12:26969400-26969422 TATTATTAACAGAAGCCTCAAGG - Intergenic
1095106152 12:38235366-38235388 TATTACCCCCAGAAGGGTCTGGG - Intergenic
1097272757 12:57787973-57787995 TCTTATCCATAGAGGGATCAAGG + Intronic
1098133014 12:67370568-67370590 TAGTATCAACAGCAGGCACAGGG + Intergenic
1099645490 12:85348633-85348655 TCTTCTCAACAGAGGGCTCATGG - Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107403392 13:40090938-40090960 ATTTATCCCCAAAAGGCTCAAGG - Intergenic
1107764441 13:43719054-43719076 ATTTATCCCCTGAAGGCTCAGGG + Intronic
1108106478 13:47016136-47016158 TTTTGACCACAGGAGGCTCAGGG - Intergenic
1109442420 13:62393315-62393337 TACTGTGCACAGAAGGCTGAAGG + Intergenic
1109966671 13:69708085-69708107 TATTATCCACAGTAGAATTAGGG + Intronic
1111442617 13:88299962-88299984 TAGTATCCACAGGAGACTGAGGG - Intergenic
1112422933 13:99269227-99269249 TTTAAACCACAGAATGCTCACGG - Intronic
1113163807 13:107414604-107414626 TTTTATCCCCAGAAAACTCAAGG - Intronic
1114216715 14:20662877-20662899 TTTTATCCACAGACTGCTCTGGG - Intergenic
1118443871 14:65834899-65834921 TGTTGTCCACAGCAGGCCCAGGG + Intergenic
1124039388 15:26086189-26086211 TATCATCCCCAGAAAGCTGAAGG + Intergenic
1132002351 15:98193007-98193029 TATTACACAGGGAAGGCTCATGG - Intergenic
1135029948 16:19030342-19030364 CACTATCCAAAGAAGGCTCAGGG - Exonic
1138827348 16:60336397-60336419 TATTACACACAGAAGTTTCAGGG - Intergenic
1141296969 16:82778957-82778979 TAATATACACAGCAGGCTCCAGG - Intronic
1141899858 16:86984105-86984127 CATTATCCACTGAAGCCTGAGGG + Intergenic
1149016446 17:51913922-51913944 TATTATCCACAGAGAACTGAGGG + Intronic
1156131002 18:33974441-33974463 AATTTTCTTCAGAAGGCTCAAGG + Intronic
1158385736 18:56989230-56989252 TATTAGCCACATATGGCTAATGG - Intronic
1160066492 18:75579670-75579692 TTTTCTCCATAGAAGGCTAAAGG + Intergenic
1167878036 19:52430485-52430507 TGTGATCCACAGAGGGCTGAGGG + Intronic
925039228 2:717190-717212 TATTACCAGCAGTAGGCTCAGGG + Intergenic
930160110 2:48146259-48146281 TAGTACCCAGTGAAGGCTCATGG + Intergenic
930415457 2:51085260-51085282 TTTTATCAACAGATGGCTAAAGG + Intergenic
931250972 2:60530247-60530269 TAATATGCAAGGAAGGCTCAAGG - Intronic
937648144 2:124288588-124288610 TATTATCCAAAGCATGCTGAAGG - Intronic
938801065 2:134763708-134763730 TACTGTACACAGAGGGCTCAGGG + Intergenic
940860479 2:158765566-158765588 TATTCTCCTCAGAAGACTCCAGG - Intergenic
943425745 2:187731310-187731332 TATTAGATACAGAAGGCACAGGG + Intergenic
944503567 2:200386554-200386576 TATAATCCACAGAGGAATCAGGG - Intronic
945569964 2:211454771-211454793 TGTTATCCCAAGAAGGCTAATGG - Intronic
946993613 2:225364778-225364800 TATTTTGCAAAGAAGGCTCAAGG + Intergenic
947077499 2:226361703-226361725 TATCATACACAGAAGACTTAAGG - Intergenic
948942170 2:241202071-241202093 TATTGTCACCAGAAGGCTGAGGG + Intronic
949032198 2:241802505-241802527 CATTCTCCACAGAGCGCTCAGGG - Intronic
1174283887 20:49458618-49458640 TATCATCCACTGAAAGCACAGGG - Intronic
1177410598 21:20725654-20725676 TTTTATCCACATAAGGATCTTGG + Intergenic
1181017753 22:20080765-20080787 TTTTGTCCACAGAATGCTCACGG + Intronic
1182505108 22:30776549-30776571 TACTATCAACAGAAGGCACTGGG + Intronic
1185185997 22:49400618-49400640 CATTATTCACAGGAGGCTTATGG - Intergenic
950024093 3:9809065-9809087 TATTATCCTCAAAAGTCACAGGG - Intronic
952600232 3:35071106-35071128 TTTTTTCCACAGAAGGGTTAGGG - Intergenic
953761822 3:45694425-45694447 TATTATTCACAGAAGTCTCCCGG + Intronic
956513911 3:70025014-70025036 TGTTATCTACAGGAAGCTCAAGG - Intergenic
956714692 3:72068375-72068397 TATTATCTACAGAATTCTCATGG + Intergenic
957035925 3:75292885-75292907 TATTGCCCACAGAAGGTTGATGG + Intergenic
962094164 3:132276538-132276560 TCTGATCCACTGAATGCTCAGGG - Intronic
966042884 3:175513277-175513299 TAAAATCCACATATGGCTCATGG - Intronic
969686372 4:8676733-8676755 TATTCTGCACAGAATGGTCAAGG + Intergenic
970130904 4:12869895-12869917 TAAATTCCTCAGAAGGCTCATGG + Intergenic
970930675 4:21507974-21507996 TTTTATCCCCAGAAGGCTTAGGG + Intronic
971878431 4:32335820-32335842 TATAATCCATAGAAATCTCATGG + Intergenic
972834580 4:42854366-42854388 TATTTTTTAAAGAAGGCTCAGGG + Intergenic
973084182 4:46033406-46033428 TATTATGCACAGCAAGCTCAAGG - Intergenic
975734842 4:77371158-77371180 TATTTTCTGCTGAAGGCTCAGGG - Intronic
976534871 4:86200309-86200331 TATTTTCCAAAAAAGGCACATGG - Intronic
980271211 4:130586306-130586328 GATTACCCACTGAAGGGTCAGGG + Intergenic
980662875 4:135888050-135888072 TATAATCCAAAGAAGGCCAAGGG - Intergenic
980995730 4:139778015-139778037 TAGTAGCCAGAGAAGGCCCATGG - Intronic
985231830 4:187827002-187827024 TATTCTCCTCACAAGGCACAAGG + Intergenic
985329290 4:188810719-188810741 TGTTAACCACAAAAGGATCATGG + Intergenic
988574434 5:32406730-32406752 TAATAACCACTGAAGACTCAAGG + Intronic
991490494 5:67178325-67178347 TATTATCCACAAACTGCTCTGGG - Intergenic
991637936 5:68724873-68724895 TTTTATACACATGAGGCTCAGGG + Intergenic
992070265 5:73141815-73141837 TATTTTCCACAGAAGGATTCAGG - Intergenic
996833539 5:127766501-127766523 TAGAATCCACAGAAGTCCCATGG - Intergenic
998366229 5:141634074-141634096 TATCATCCATAGAAGAGTCAGGG - Intronic
1001024546 5:168213029-168213051 CATTATCAACAGAAGGATCAAGG - Intronic
1001443845 5:171767474-171767496 TAGATTCCACAAAAGGCTCATGG - Intergenic
1001528570 5:172446222-172446244 TACTGCCCAGAGAAGGCTCAGGG + Intronic
1001611281 5:173004155-173004177 TATTCACCAAAGGAGGCTCAAGG - Intronic
1001875580 5:175197439-175197461 TATTAACTACACAAGCCTCAAGG + Intergenic
1001908870 5:175497287-175497309 TAATCTCCCCTGAAGGCTCATGG - Intronic
1005567315 6:27109438-27109460 TTTTATCCAAAGAATGTTCAAGG - Intergenic
1008536399 6:52509390-52509412 TACCATCCACAATAGGCTCAGGG + Intronic
1010168931 6:72951587-72951609 TATTATTAATAGAAGGCTAAGGG - Intronic
1010472853 6:76250562-76250584 TGTTATCCACAGAGGGCATATGG - Intergenic
1018780075 6:167055260-167055282 TATTAGTCACAGAAGCCTCCTGG + Intergenic
1019145435 6:169972734-169972756 CATTATCCTCAGAAGGCCCTGGG - Intergenic
1021934893 7:25620670-25620692 TATTTTACACAGCAAGCTCAAGG - Intergenic
1022087727 7:27085264-27085286 TATTATACACATAAGCCTAAAGG + Intergenic
1027745863 7:82073126-82073148 TATTATCCTCAGAAACCTCATGG + Intronic
1027828655 7:83149763-83149785 GATTATCCACGGAAAGGTCATGG + Intronic
1029510252 7:100990069-100990091 TATATTCCACAGAAGGCACAAGG + Intronic
1030454586 7:109757432-109757454 TATCATCCAGAAAAAGCTCAGGG - Intergenic
1033467306 7:141606264-141606286 TTTAAACCACAGAAGGCTCAAGG - Intronic
1036942430 8:13064494-13064516 TATTATCCAGAGAGGGCTAGAGG + Intergenic
1037739028 8:21590560-21590582 TACTCTGCACAGAAGGCTGAGGG + Intergenic
1040975800 8:53193610-53193632 AATACTCCACTGAAGGCTCAAGG + Intergenic
1040985306 8:53287370-53287392 TAATATCTGCAGAGGGCTCAGGG - Intergenic
1044504128 8:92997383-92997405 TATCAACCTCAGAAGGCTAAAGG + Intronic
1044819926 8:96149053-96149075 TTTTGCCCACAGATGGCTCATGG - Intronic
1045425810 8:102064654-102064676 TATTAACCTCTGAAAGCTCAGGG + Intronic
1046732196 8:117737800-117737822 ATTTATCCACAGAAGGCAAAGGG - Intergenic
1047433120 8:124809776-124809798 TAGCACCCACAGAAGCCTCATGG + Intergenic
1048694426 8:137009249-137009271 TATTGTCCACAGCAGCTTCATGG + Intergenic
1048863415 8:138740800-138740822 CATCATCCAGAGAAGCCTCAGGG + Intronic
1052426963 9:28317556-28317578 TATAATCCATAGAACCCTCATGG - Intronic
1052832361 9:33226968-33226990 TATTCTCCTTAGAAGGGTCAGGG - Intronic
1055326027 9:75130770-75130792 GTTTATTAACAGAAGGCTCATGG - Intronic
1059753170 9:117268175-117268197 TTTTACCCACAGAAAGCTAATGG - Intronic
1187046881 X:15655658-15655680 TCTTAGCCAGAGAAGTCTCATGG - Intronic
1187492591 X:19765944-19765966 TAGTATTCACAGAAGGCAAAAGG - Intronic
1188871670 X:35381260-35381282 TATTCCCCACAGAAACCTCAGGG - Intergenic
1193755264 X:85401755-85401777 TTTAATCCAAAAAAGGCTCAAGG - Intergenic
1194347083 X:92779205-92779227 TATTATCCTTAGAAGACTAATGG + Intergenic
1195816953 X:108898322-108898344 TATGTTCCACATAAGCCTCATGG + Intergenic
1196055594 X:111351708-111351730 TAGTAAATACAGAAGGCTCAAGG + Intronic
1198396564 X:136225007-136225029 TATTACCAACAAAAGGCTTACGG + Intronic
1199654774 X:149983376-149983398 TATTAACCAAAGAAGCCACAAGG + Intergenic
1200655409 Y:5895843-5895865 TATTATCCTTAGAAGACTAATGG + Intergenic
1201913688 Y:19159128-19159150 TATTCTCCTCCAAAGGCTCATGG + Intergenic