ID: 1081565870

View in Genome Browser
Species Human (GRCh38)
Location 11:44260965-44260987
Sequence TCACTCACACACATAGAGCT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 335}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081565870_1081565875 2 Left 1081565870 11:44260965-44260987 CCTAGCTCTATGTGTGTGAGTGA 0: 1
1: 0
2: 0
3: 37
4: 335
Right 1081565875 11:44260990-44261012 AGGGAAGAAAGGAGAGGCCGAGG 0: 1
1: 0
2: 9
3: 106
4: 1028
1081565870_1081565877 13 Left 1081565870 11:44260965-44260987 CCTAGCTCTATGTGTGTGAGTGA 0: 1
1: 0
2: 0
3: 37
4: 335
Right 1081565877 11:44261001-44261023 GAGAGGCCGAGGTTAGGTCATGG 0: 1
1: 0
2: 0
3: 12
4: 161
1081565870_1081565876 7 Left 1081565870 11:44260965-44260987 CCTAGCTCTATGTGTGTGAGTGA 0: 1
1: 0
2: 0
3: 37
4: 335
Right 1081565876 11:44260995-44261017 AGAAAGGAGAGGCCGAGGTTAGG 0: 1
1: 1
2: 2
3: 25
4: 346
1081565870_1081565874 -4 Left 1081565870 11:44260965-44260987 CCTAGCTCTATGTGTGTGAGTGA 0: 1
1: 0
2: 0
3: 37
4: 335
Right 1081565874 11:44260984-44261006 GTGAAGAGGGAAGAAAGGAGAGG 0: 1
1: 0
2: 19
3: 197
4: 1808
1081565870_1081565873 -9 Left 1081565870 11:44260965-44260987 CCTAGCTCTATGTGTGTGAGTGA 0: 1
1: 0
2: 0
3: 37
4: 335
Right 1081565873 11:44260979-44261001 TGTGAGTGAAGAGGGAAGAAAGG 0: 1
1: 1
2: 5
3: 77
4: 880

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081565870 Original CRISPR TCACTCACACACATAGAGCT AGG (reversed) Exonic
900094717 1:935674-935696 CCACGCTCACACACAGAGCTAGG + Intronic
900766430 1:4509095-4509117 ACACACACACACAATGAGCTGGG - Intergenic
901508775 1:9703637-9703659 ACTCTCACACACATAAAGCTGGG - Intronic
903389926 1:22956415-22956437 TCACTCCCACACACAGAACTGGG - Intronic
904922121 1:34016006-34016028 ACACACACACACACAGAGCAAGG - Intronic
905349610 1:37336178-37336200 ACACACACACACACAAAGCTTGG + Intergenic
906524802 1:46487855-46487877 TCAGTCACACACACAGACATGGG - Intergenic
906925349 1:50109996-50110018 ACACACACACACACAGGGCTGGG - Intronic
907425529 1:54376918-54376940 TGACTCACACACAAAGAGCCTGG + Intronic
910105965 1:83631436-83631458 ACACACACACACACAGAGCTAGG + Intergenic
910303799 1:85738899-85738921 TCACTAAAACACACATAGCTGGG + Intronic
910587347 1:88894048-88894070 ACACACACACACACAGAGCTGGG + Intergenic
911485264 1:98497505-98497527 TCACTAACACACAAACAGCATGG - Intergenic
912081151 1:105938029-105938051 TCACACACACACACAGAAATTGG - Intergenic
912890685 1:113526452-113526474 TCTCTCTCATACGTAGAGCTTGG - Intronic
913505859 1:119515682-119515704 TGACTAACACACATATAGCCAGG - Intergenic
913716894 1:121544513-121544535 ACACACACACACACAGAGCATGG - Intergenic
914417380 1:147496428-147496450 ACACACACACACACAGAGTTAGG + Intergenic
914449307 1:147776579-147776601 TCACTGACACACATACATATAGG - Intergenic
915130142 1:153690153-153690175 ACACACACACACACAGAGCTGGG + Intronic
915684063 1:157613464-157613486 TCAGTAACACAGATAGAGCTGGG + Intergenic
915785675 1:158608755-158608777 TAACTCACACACATTAAACTAGG - Intergenic
915793230 1:158698116-158698138 ACACACACACACAGAGAACTAGG + Intergenic
918614838 1:186532263-186532285 TCAGGCACACACAGAGACCTGGG - Intergenic
919308928 1:195880076-195880098 TCACTCATACATATGCAGCTCGG + Intergenic
919790621 1:201288569-201288591 TCACTCACACAGATCCAGCATGG + Intronic
922118560 1:222638534-222638556 ACACACACACACACACAGCTGGG + Intronic
922399678 1:225239234-225239256 TCAGGCACACACAGAGACCTAGG - Intronic
923145150 1:231192603-231192625 TCATTCACACACAAAGGACTGGG + Intronic
924708299 1:246515417-246515439 TCACTCACACACAGAGGCCATGG - Intergenic
1063735427 10:8748533-8748555 ACACACACAGTCATAGAGCTGGG + Intergenic
1063751880 10:8958511-8958533 ACACACACACACACACAGCTGGG + Intergenic
1065433145 10:25680336-25680358 TCCCTCAAACACAGAAAGCTTGG - Intergenic
1070372698 10:75799673-75799695 ACACACACACACACAAAGCTAGG - Intronic
1071072329 10:81709390-81709412 TCTTTCACACACATATGGCTAGG + Intergenic
1071249056 10:83797321-83797343 ACACACACACACACAGAGCAAGG - Intergenic
1072586497 10:96787395-96787417 TCACCCCCACACAAAGTGCTGGG + Intergenic
1073596649 10:104807174-104807196 GCACACACACACAGAGAGCAAGG - Intronic
1073749980 10:106514399-106514421 ACACACACACACACAGAGCCAGG - Intergenic
1073767214 10:106695892-106695914 CCACACACACACATAGTTCTAGG + Intronic
1073798569 10:107015344-107015366 ACACACACACAAATAGAGCAGGG + Intronic
1075786731 10:125055030-125055052 TCACGCACACCCATAAATCTGGG + Intronic
1077534206 11:3111948-3111970 GCACACACACACACACAGCTTGG - Intronic
1077616455 11:3677982-3678004 ACACACACACACACAAAGCTGGG + Intronic
1078521225 11:12065504-12065526 TCACACACTCACACATAGCTGGG - Intergenic
1078689181 11:13561891-13561913 ACAGTCACACACATAGAGTTGGG - Intergenic
1079059243 11:17233556-17233578 ACACACACACACATACACCTAGG - Intronic
1079128087 11:17732881-17732903 ACACACACACACACACAGCTGGG - Intergenic
1080065624 11:28009151-28009173 TAACTCACATACAAAGAGTTTGG - Intergenic
1080838555 11:35963412-35963434 ACACACACACACACAGAACTGGG - Intronic
1081297083 11:41404459-41404481 ACACACACACACATAGCCCTGGG - Intronic
1081565870 11:44260965-44260987 TCACTCACACACATAGAGCTAGG - Exonic
1082125844 11:48430222-48430244 TCAGTCACACACAGAGACCCAGG - Intergenic
1083141834 11:60728556-60728578 ACACTCACACACACAGAGAGAGG - Intergenic
1084439247 11:69161946-69161968 ACACACACACACACAGAGCCAGG + Intergenic
1085133268 11:74060377-74060399 TGACTGACACCCATACAGCTGGG + Intronic
1085215036 11:74822004-74822026 TCACTCACACACACACACCCTGG - Intronic
1090868127 11:130720263-130720285 ACACACACACACACCGAGCTAGG + Intergenic
1090868132 11:130720327-130720349 ACACACACACACACCGAGCTAGG + Intergenic
1091108955 11:132947444-132947466 TCACTCAGAAATATTGAGCTAGG - Intronic
1093431839 12:19093594-19093616 GCACACACACACACAAAGCTAGG - Intergenic
1094005500 12:25745346-25745368 TCACAGACACACAAAAAGCTAGG - Intergenic
1094329875 12:29279755-29279777 TCAATCAGAGAGATAGAGCTTGG + Intronic
1098467457 12:70804132-70804154 ACACACACACACACAGAGCCAGG - Intronic
1098922442 12:76314809-76314831 ACACACACACACACAGAGCCTGG - Intergenic
1100100086 12:91092310-91092332 TCAGTCACACACAGAGACCCAGG - Intergenic
1100128859 12:91465061-91465083 ACACAGACACACATAGTGCTTGG - Intergenic
1100134882 12:91543507-91543529 TCAGTCTGACACACAGAGCTAGG + Intergenic
1100134889 12:91543553-91543575 TCAGGCACACACAGAGAACTGGG + Intergenic
1100637773 12:96451736-96451758 CCACACACACACACAGAGTTAGG + Intergenic
1100780528 12:98020971-98020993 ACACACACACACACACAGCTTGG + Intergenic
1101260288 12:103022239-103022261 ACACACACACACACAGAGTTGGG - Intergenic
1101819634 12:108173801-108173823 ACACACACACACAGAGAGCCAGG - Intronic
1102202857 12:111069513-111069535 ACACACACACACACAGAGCAAGG - Intronic
1102230567 12:111259026-111259048 ACACACACACACACACAGCTGGG - Intronic
1104050257 12:125189871-125189893 CCACCCAGCCACATAGAGCTGGG - Intronic
1104105682 12:125656912-125656934 TCTCTTACACACATACAGCAGGG + Exonic
1104734539 12:131128874-131128896 TCACTCACACCCAGACAGCAGGG - Intronic
1104734546 12:131128905-131128927 TCACTCACACCCAGACAGCAGGG - Intronic
1104734553 12:131128936-131128958 TCACTCACACCCAGACAGCAGGG - Intronic
1104734581 12:131129058-131129080 TCACTCACACCCAGACAGCAGGG - Intronic
1104734588 12:131129089-131129111 TCACTCACACCCAGACAGCAGGG - Intronic
1104734595 12:131129120-131129142 TCACTCACACCCAGACAGCAGGG - Intronic
1104734600 12:131129151-131129173 TCACTCACACTCAGACAGCAGGG - Intronic
1104734613 12:131129212-131129234 TCACTCACACCCAGACAGCAGGG - Intronic
1104734620 12:131129243-131129265 TCACTCACACCCAGACAGCAGGG - Intronic
1104734636 12:131129305-131129327 TCACTCACACCCAGACAGCAGGG - Intronic
1104734657 12:131129398-131129420 TCACTCACACCCAGACAGCAGGG - Intronic
1104734671 12:131129456-131129478 TCACTCACACCCAGACAGCAGGG - Intronic
1104734678 12:131129487-131129509 TCACTCACACCCAGACAGCAGGG - Intronic
1105834868 13:24201053-24201075 ACACACACACACACAGAGTTTGG + Intronic
1106318773 13:28618925-28618947 TCTCTCACACACACAGAGGATGG + Intergenic
1106681323 13:32011516-32011538 TCACACACATACAAAGAGCATGG - Intergenic
1107186028 13:37521844-37521866 ACACACACACACATAGACCTAGG - Intergenic
1109097820 13:58141390-58141412 TCATTCACAAACATACAGTTTGG + Intergenic
1110338543 13:74362199-74362221 ACACACACACACACAGAGTTGGG - Intergenic
1110851340 13:80248716-80248738 ACACACACACACACAGAGCTGGG + Intergenic
1111068320 13:83127995-83128017 GCACACACACACACAGAGATGGG + Intergenic
1111183987 13:84705182-84705204 ACACACACACACACAGAGTTCGG - Intergenic
1111296248 13:86281967-86281989 TAACTCTCACACACAGAACTTGG - Intergenic
1111881797 13:93966352-93966374 ACATTCACACACATATACCTTGG - Intronic
1112151526 13:96769727-96769749 ACACACACACACACAGAGCTAGG - Intronic
1113014910 13:105817927-105817949 ACACACACACACACAGAGGTTGG + Intergenic
1113118990 13:106906107-106906129 ACACACACACACACAGAGCAAGG + Intergenic
1114136374 14:19856405-19856427 ACACACACACACACACAGCTAGG + Intergenic
1114155007 14:20092103-20092125 ACACACACACACATAGAGAGAGG - Intergenic
1115146191 14:30228786-30228808 TCATTCACACATATAGAAATGGG + Intergenic
1117241295 14:53836736-53836758 TCACCCACACTTAGAGAGCTAGG + Intergenic
1117452700 14:55866073-55866095 TCACTCTGACACACAGAGCTAGG - Intergenic
1119172523 14:72545904-72545926 TGACACACACACACACAGCTGGG - Intronic
1119840577 14:77789885-77789907 GGACTCACACACAAAGACCTGGG - Intergenic
1120047640 14:79826425-79826447 ACACTCACACATATAGAGAATGG - Intronic
1120450496 14:84660535-84660557 ACACACACACACACAGAGCATGG - Intergenic
1120663307 14:87276320-87276342 TCCCTCACACATATATATCTGGG + Intergenic
1121119332 14:91366188-91366210 ACACACACACACACAGGGCTGGG + Intronic
1121375525 14:93406709-93406731 GCTCTAACACACAAAGAGCTTGG + Intronic
1121699324 14:95940446-95940468 ACACACACACACACAGAGTTAGG + Intergenic
1122088638 14:99323606-99323628 TCCCTCAGACAAATAGAGCCTGG - Intergenic
1122602306 14:102927965-102927987 TCCCTCACACACCAAGAGCGCGG + Intronic
1122985845 14:105211309-105211331 GCTCTGACACACACAGAGCTGGG + Intronic
1123582231 15:21725732-21725754 TCACTCATTCACATAAAACTTGG - Intergenic
1123618881 15:22168328-22168350 TCACTCATTCACATAAAACTTGG - Intergenic
1123941709 15:25219775-25219797 CACCTCACACACACAGAGCTGGG - Intergenic
1125200524 15:37097926-37097948 ACACTCACACACAGTAAGCTGGG + Intronic
1125733526 15:41907817-41907839 ACACACACACACACAGAGCCTGG - Intronic
1126957913 15:53955289-53955311 ACACACACACACATAAAACTAGG + Intergenic
1127559388 15:60120596-60120618 TAAGTGACACACACAGAGCTTGG - Intergenic
1127658532 15:61078322-61078344 ACACACACACACACAGAGCCAGG - Intronic
1127674332 15:61226602-61226624 TAGCTCACACACATAAAGATTGG + Intronic
1127748931 15:62012244-62012266 ACACACACACACACAAAGCTTGG + Intronic
1128823813 15:70690173-70690195 ACACACACACACACACAGCTTGG + Intronic
1129478977 15:75808105-75808127 TCACTCACATCCAAAGAGCCCGG + Intergenic
1130370540 15:83283093-83283115 TCACTCACACAATTAAGGCTGGG + Intronic
1130704045 15:86215188-86215210 TCACACACACACACAGAGCCAGG - Intronic
1130921090 15:88345111-88345133 CCACTCAGGCACACAGAGCTGGG - Intergenic
1131149592 15:90038700-90038722 ACACACACACACACAGAGCAGGG - Intronic
1132006618 15:98233271-98233293 ACACACACACACACACAGCTGGG - Intergenic
1132899473 16:2245315-2245337 TGACTCACACAAGCAGAGCTGGG + Intronic
1133523900 16:6585057-6585079 TCTCTGAGACACAGAGAGCTTGG + Intronic
1133619128 16:7509383-7509405 ACACACACACACACAGGGCTTGG - Intronic
1136629962 16:31484258-31484280 GCACACACACACAAAAAGCTGGG + Intronic
1136987710 16:35126245-35126267 ACACACACACACACAGAGATTGG + Intergenic
1137264738 16:46859540-46859562 TCACACACACACACAGGGCCAGG - Intergenic
1138477270 16:57279113-57279135 TCATTCCCACATATAGTGCTAGG + Intronic
1139012856 16:62654320-62654342 ATACACACACACATAGAGCTGGG + Intergenic
1140361525 16:74348367-74348389 ACACACACACACAAAGGGCTAGG + Intergenic
1140879985 16:79189416-79189438 ACACACACACACACAAAGCTGGG - Intronic
1141066422 16:80917409-80917431 GCGCTCACTCACATAGAGATGGG - Intergenic
1141982223 16:87557591-87557613 TAACTCACACACACAGATCCTGG + Intergenic
1143920715 17:10329146-10329168 TCACTCCCAGGCATCGAGCTTGG - Intronic
1146308702 17:31750605-31750627 GCACACACACACACAGAGCCAGG + Intergenic
1147487589 17:40832395-40832417 ACACACACACACACAGAGCCTGG + Intronic
1147958923 17:44154380-44154402 TCTCTGACAGACCTAGAGCTGGG - Intronic
1148253343 17:46105879-46105901 ACACACACACACACAGAGCAAGG + Intronic
1148337045 17:46848936-46848958 ACACACACACACACAGAGCTTGG + Intronic
1148752422 17:49952915-49952937 TCACTCACCCACCCTGAGCTTGG - Intergenic
1149976553 17:61271582-61271604 ACACACACACACACAGAGCTGGG - Intronic
1150249057 17:63696143-63696165 TCAGACACAGACATAGAGCTGGG - Exonic
1150975508 17:70081799-70081821 ACACACACACACACAGAGCATGG - Intronic
1151183406 17:72346030-72346052 ACACACACACACACAAAGCTGGG - Intergenic
1151212844 17:72557857-72557879 TCTCTCACACACATACTCCTGGG + Intergenic
1151810167 17:76435257-76435279 ATACTCACACACATAGAGTTTGG + Intronic
1152665164 17:81564106-81564128 ACACACACACACAAAGAGCAGGG + Intronic
1153395736 18:4618353-4618375 ACAGACACACACAAAGAGCTAGG - Intergenic
1154052091 18:10970688-10970710 ACACACACACACACACAGCTGGG + Intronic
1156748074 18:40416704-40416726 TCACTGAGGCACATAGAGGTGGG + Intergenic
1157067925 18:44373810-44373832 TCAGGCACACACACAGAACTGGG - Intergenic
1157537746 18:48472626-48472648 ACACACACACACAGAGAGCAAGG + Intergenic
1158825019 18:61208898-61208920 TCACTACCACACCTAGGGCTGGG + Intergenic
1158859756 18:61581026-61581048 ACACACACACACACAGAGCCAGG + Intergenic
1160927584 19:1554369-1554391 TCCCACACACCCAGAGAGCTGGG + Intergenic
1161066524 19:2241205-2241227 GCACTCCCACACACAGATCTCGG - Intronic
1161091765 19:2363771-2363793 ACACTCACACACAGAGTTCTTGG - Intergenic
1161801374 19:6418294-6418316 TGCCTCACACACACAAAGCTGGG + Intronic
1163096043 19:15057855-15057877 TCACTGTCTCACCTAGAGCTGGG - Exonic
1163197232 19:15731343-15731365 TCACACACACACATGGCCCTAGG + Intergenic
1164089150 19:21932453-21932475 TCACTCTGATACATAGAGCTGGG + Intergenic
1164193413 19:22932254-22932276 TCACTCTGATACATAGAGCTGGG + Intergenic
1165226317 19:34357697-34357719 TCACTGACACACACAGGCCTGGG - Intergenic
1166306034 19:41937464-41937486 TCAGACACACACATAGCTCTGGG + Intergenic
1168512129 19:56981226-56981248 AAGCTCACACACACAGAGCTGGG + Intergenic
1168595257 19:57670354-57670376 TCAATCACTGACATGGAGCTGGG + Exonic
925156594 2:1652923-1652945 ACACACACACACACAGAGCACGG - Intronic
927136798 2:20102960-20102982 AAACTCAGACAAATAGAGCTAGG - Intergenic
927229047 2:20801921-20801943 ACACACACACACATAGAATTTGG - Intronic
927414168 2:22859277-22859299 ACACACACACACATCGAGCAAGG + Intergenic
927415020 2:22870276-22870298 TCACTCAAACTCATTGAGGTGGG - Intergenic
927810441 2:26177642-26177664 ACACACACACACACAGAACTGGG - Intronic
928135426 2:28684256-28684278 CCACTCTCCCACAAAGAGCTCGG + Intergenic
929636601 2:43528737-43528759 ACACTCACACACATAGGTCTAGG + Intronic
930563118 2:52985350-52985372 ACACACACACACATTGAGTTGGG + Intergenic
932957052 2:76364334-76364356 TTACACACACACGCAGAGCTAGG - Intergenic
934057640 2:88265473-88265495 ACACACACACACACGGAGCTTGG - Intergenic
935510988 2:103973661-103973683 ACACACACACACATAGATTTAGG - Intergenic
937626273 2:124047399-124047421 TCACTGGTACACAGAGAGCTTGG + Intronic
937698489 2:124836592-124836614 GCACACATTCACATAGAGCTGGG - Intronic
938697658 2:133849057-133849079 TCACACATTCACATACAGCTAGG - Intergenic
939289602 2:140176981-140177003 GCACGCACACACATACAGCAAGG + Intergenic
939605082 2:144244570-144244592 TCAGTCACACACATTAAACTAGG + Intronic
940898006 2:159099572-159099594 GCACACACACACACAGACCTAGG - Intronic
941788018 2:169520145-169520167 ACACACACACACACAGAGCTAGG - Intronic
942451182 2:176108652-176108674 ACACACACACACACAGAGCCTGG - Intronic
943374551 2:187059503-187059525 ACACACACACACACAGAGCTAGG + Intergenic
943689812 2:190858100-190858122 TCACACACACACAGGGAACTTGG + Intergenic
944983633 2:205150204-205150226 ACACACACACACACAGAGCCTGG - Intronic
945126197 2:206513125-206513147 TCACTTAAACACATAGAGGCCGG - Intronic
946526681 2:220528339-220528361 TCTCTCACACACACACAGATTGG - Intergenic
946733437 2:222731066-222731088 ACACACACACACACAGAGGTAGG + Intergenic
947602469 2:231462887-231462909 TCACCCCCACATGTAGAGCTGGG - Intronic
947834458 2:233165335-233165357 ACACTCACACACATAGATATGGG - Intronic
948697716 2:239741680-239741702 CCATCCACACACATGGAGCTGGG + Intergenic
1169388587 20:5171334-5171356 GCACTCACACACAGAAAGCCCGG - Intronic
1169747339 20:8955846-8955868 ACACACACACATATAGAGCTGGG + Intronic
1170970121 20:21107758-21107780 CCACTAACACACAAAGAGATGGG + Intergenic
1171464659 20:25319138-25319160 TCTCTCACACACGAAGACCTTGG + Intronic
1172272914 20:33664421-33664443 TCACTCCTACACATTGTGCTTGG + Intronic
1172421351 20:34821144-34821166 ACACTCAAACACATAGATCAGGG + Exonic
1174467456 20:50729248-50729270 ACACTCACTCACACAGAGCTGGG + Intergenic
1174831558 20:53817805-53817827 CCAAAGACACACATAGAGCTGGG - Intergenic
1175446152 20:59021137-59021159 TAACTCACACACAGAGAAGTGGG + Intronic
1175953689 20:62597112-62597134 TCACTCACACTCATGGAGCCAGG + Intergenic
1176367083 21:6039697-6039719 ACACACACACACAAATAGCTGGG - Intergenic
1177117555 21:17104676-17104698 TCAGTCACACACAGAGACCCAGG + Intergenic
1177816695 21:25985837-25985859 TCACTCACACTAATTGAGATGGG - Intronic
1178418783 21:32426540-32426562 GCACTCACATACAGACAGCTTGG + Intronic
1178492721 21:33063467-33063489 ACACTTACACAAATAGAGCTGGG + Intergenic
1179756435 21:43498849-43498871 ACACACACACACAAATAGCTGGG + Intergenic
1180657239 22:17432875-17432897 ACACTCAGACAGATAGAGCTGGG - Intronic
1181272059 22:21664981-21665003 ACACACACACACAAAGTGCTGGG + Intronic
1181287844 22:21767242-21767264 TCACTCACTGACAGAAAGCTGGG - Intronic
1182607237 22:31515537-31515559 ACACACACACACACAGAGCCAGG - Intronic
1183351849 22:37338939-37338961 TCACACACACAAATTGAGCCTGG + Intergenic
1183378326 22:37478088-37478110 TCACTCATACACAGAGCCCTAGG + Intronic
1183685129 22:39357339-39357361 TCACTCCCATGCATAGACCTGGG - Intronic
1184382571 22:44155144-44155166 TCACTCACCATCACAGAGCTGGG - Intronic
1184936130 22:47723367-47723389 ACACACACACACATAGAGTGAGG + Intergenic
950936935 3:16848512-16848534 TTACTAAAACAAATAGAGCTAGG - Intronic
951719392 3:25681704-25681726 TAAGTCAAACACACAGAGCTAGG + Intergenic
953199660 3:40767629-40767651 ACACCCACACACATACAGCCAGG + Intergenic
953307968 3:41847665-41847687 TCAATGACACAAACAGAGCTAGG + Intronic
954574460 3:51668060-51668082 ACACACACACACACACAGCTGGG - Exonic
958189280 3:90163875-90163897 AAACTCACAAACATAAAGCTTGG - Intergenic
958268939 3:91474315-91474337 GCACCCACAGACATAGAGATAGG + Intergenic
958411586 3:93823490-93823512 AAACTCACAAACATACAGCTTGG - Intergenic
959027427 3:101256587-101256609 ACACACACACACAGAGAACTAGG + Intronic
961353936 3:126322138-126322160 TAAATCACATACATAGAGGTGGG - Intergenic
961972583 3:130986101-130986123 TCACTGCCACCCAGAGAGCTGGG + Intronic
962517203 3:136163357-136163379 ATACACACACACATAGTGCTAGG - Intronic
963443035 3:145365392-145365414 ACACTCACACACACATACCTAGG - Intergenic
963695038 3:148555908-148555930 ACACACACACACACAGAGCAAGG - Intergenic
963729454 3:148957363-148957385 TAACTTCCACACATAGAGCAGGG + Intergenic
964846604 3:161051155-161051177 TCACCCACACCCATACATCTGGG + Intronic
970119510 4:12737634-12737656 TCACACACACACATATATATGGG + Intergenic
972570001 4:40301792-40301814 TCAACCACACACATAGACCCAGG - Intergenic
975878558 4:78873651-78873673 ACACACACACACACAGAGGTTGG - Intronic
976385033 4:84447294-84447316 ACACTAGCACACAAAGAGCTGGG + Intergenic
976909394 4:90281941-90281963 TCACTCTCACACATTGTGATGGG + Intronic
978095539 4:104771465-104771487 ACACACACACACACACAGCTTGG - Intergenic
979360585 4:119759403-119759425 TCACTAATACACATAGGGCGCGG - Intergenic
983991063 4:174120509-174120531 TCTCACACACACACAGAGATTGG - Intergenic
986309870 5:6544011-6544033 ACACACACACACAGAGAGCAAGG + Intergenic
987057410 5:14207348-14207370 ACACACACACACACAGAGCCAGG + Intronic
987634758 5:20525820-20525842 ACACACACACACATTGAGCCAGG + Intronic
988526040 5:31988133-31988155 TTACTCACACACATACACATAGG + Intronic
988966120 5:36419753-36419775 ACACACACACACACAGATCTGGG + Intergenic
990007140 5:50956838-50956860 ACACACACACACTAAGAGCTGGG - Intergenic
990331246 5:54728074-54728096 TCTCTCACAGACAAAGATCTTGG - Intergenic
990811675 5:59732428-59732450 TCACTCACGCACAGAGAGAAAGG + Intronic
990889538 5:60633043-60633065 TCAGATACACACAAAGAGCTTGG - Intronic
992035149 5:72766359-72766381 ACACACACACACATACATCTGGG + Intergenic
992410926 5:76504572-76504594 GCAATCACACACACAGATCTGGG - Intronic
992940832 5:81759541-81759563 TCACACAGCCACATGGAGCTGGG - Intergenic
994001764 5:94789635-94789657 GTACTCACACACATATATCTGGG + Intronic
994153596 5:96477312-96477334 ACACACACACACACACAGCTGGG + Intergenic
994260872 5:97657037-97657059 ACACACACACACACACAGCTGGG + Intergenic
1000078191 5:157815137-157815159 ACACACACACACAAATAGCTGGG + Intronic
1000455064 5:161438351-161438373 TCCCTCAAACACATACAGCTTGG + Intronic
1000603896 5:163307577-163307599 ACACACACACACACAGAGCTGGG - Intergenic
1000663667 5:163967893-163967915 ACACACACACACACAGAACTAGG - Intergenic
1001133424 5:169082563-169082585 ACACACACACACATAGAGACAGG - Intronic
1001456952 5:171870401-171870423 ACACACACACACAAAGAGCCTGG + Intronic
1002630099 5:180567808-180567830 ACACACACACACACAGAGTTGGG - Intronic
1002830658 6:817467-817489 ACACACACACACGTAGAGCCAGG - Intergenic
1004424462 6:15497932-15497954 ACACAGACACACATAGAGGTAGG - Intronic
1004579087 6:16930346-16930368 ACACACACACACATACAACTAGG + Intergenic
1006337817 6:33429618-33429640 GCACTCACACACACACAGCAAGG - Intronic
1006519563 6:34563403-34563425 GCAGTCACACACATGGACCTCGG + Intergenic
1006927396 6:37664621-37664643 ACACACACACACACAGAGGTGGG + Intronic
1008911725 6:56740660-56740682 TCAGTCACAGACAGGGAGCTGGG + Intronic
1008986289 6:57547422-57547444 GCACCCACAGACATAGAGATAGG - Intronic
1009174249 6:60439982-60440004 GCACCCACAGACATAGAGATAGG - Intergenic
1009321322 6:62293015-62293037 ACACACACACACATAAAACTAGG + Intergenic
1009756396 6:67945929-67945951 ACACACACACACATATGGCTGGG - Intergenic
1011420119 6:87163154-87163176 TCAGTTACATACATAGGGCTGGG + Intronic
1012588988 6:100956167-100956189 ACACACACACACACAGAGCAAGG - Intergenic
1012821106 6:104085391-104085413 ACACACACACACAAAGAACTTGG - Intergenic
1013569781 6:111410485-111410507 TCTCTCACACACATACAGAGTGG - Intronic
1014729071 6:125009364-125009386 CCTCTCACAGACATAGAGCCTGG + Intronic
1015086904 6:129305604-129305626 ACACACACACACATTAAGCTAGG - Intronic
1015137332 6:129888188-129888210 ACACACACACACAAAGAGATAGG - Intergenic
1015472695 6:133623816-133623838 CCACTCTAACACATAGAACTAGG + Intergenic
1015494000 6:133861161-133861183 ACACACACACACAAATAGCTAGG - Intergenic
1016079556 6:139839155-139839177 TCCTTCACACATACAGAGCTGGG + Intergenic
1016196737 6:141353099-141353121 ACACACACACACACACAGCTTGG + Intergenic
1016764914 6:147781796-147781818 ACACACACACACACACAGCTTGG + Intergenic
1016984362 6:149884101-149884123 TCCCTCTCACACATAGAGGAGGG + Intronic
1017202788 6:151773858-151773880 TCACCCACAGACATTGACCTAGG - Intronic
1017983189 6:159420622-159420644 TCACACACACTCATTGTGCTGGG - Intergenic
1018148772 6:160919277-160919299 ACACACACACACACACAGCTGGG - Intergenic
1019122602 6:169814663-169814685 ACACACACACACACAGAGCATGG - Intergenic
1019980571 7:4618841-4618863 ACACACACACACACAGAGCCAGG + Intergenic
1020071365 7:5229011-5229033 ACACACACACACAAAAAGCTAGG - Intronic
1024938907 7:54741749-54741771 ACACACACACACATACATCTTGG - Intergenic
1025758452 7:64368346-64368368 TGACTCACACACACAGAGCCAGG + Intergenic
1025819042 7:64946326-64946348 TTCCTCAGAGACATAGAGCTTGG + Intergenic
1027680737 7:81217977-81217999 ACACACACACACAAAGTGCTGGG - Intergenic
1027938378 7:84637684-84637706 TCCCACACACACATACAGCCTGG - Intergenic
1030412364 7:109197515-109197537 TCCCTAACAAAAATAGAGCTGGG - Intergenic
1031140135 7:117933232-117933254 TCAATCACTCAGAAAGAGCTAGG - Intergenic
1031920104 7:127594039-127594061 GCACACACACACACACAGCTTGG - Intronic
1031920110 7:127594155-127594177 ACACACACACACACACAGCTTGG - Intronic
1031920115 7:127594243-127594265 ACACACACACACACACAGCTTGG - Intronic
1032779411 7:135151659-135151681 TCACTCACATATAGAGGGCTTGG - Intronic
1032902314 7:136323744-136323766 CCACACACACACACAGATCTGGG - Intergenic
1033288282 7:140061083-140061105 TTTCTCACACACATAGCCCTTGG + Intronic
1035264002 7:157679690-157679712 TGACTCACACACACAGGGGTCGG + Intronic
1035293007 7:157851646-157851668 ACACTCAGGCACCTAGAGCTGGG - Intronic
1036753027 8:11455198-11455220 TCACACACACACACAGAGCAAGG - Intronic
1036753218 8:11456204-11456226 TCACTCACACTCACACAGCAAGG - Intronic
1039820450 8:41129797-41129819 TCAGGCACACACAGAGACCTAGG + Intergenic
1039910175 8:41820318-41820340 ACACACACACACATTTAGCTTGG - Intronic
1040407589 8:47121554-47121576 TCACACACACACATATAGTAAGG - Intergenic
1041078925 8:54196024-54196046 ACACACACACACACACAGCTGGG - Intergenic
1043778314 8:84298791-84298813 TCACACACACACACAAAGCTAGG - Intronic
1046265056 8:111819948-111819970 TCACTCAGTGACATAGAGCTAGG + Intergenic
1046534556 8:115492450-115492472 ACACACACACACACAGTGCTTGG - Intronic
1046762434 8:118035235-118035257 TCACTCGCACACAGGAAGCTTGG + Intronic
1047468449 8:125143108-125143130 ACACACACACACACAGAGGTAGG + Intronic
1047741571 8:127810907-127810929 GAACTCACACACATGGTGCTGGG - Intergenic
1049252389 8:141596273-141596295 GCCCTCACACACCTACAGCTGGG - Intergenic
1052881815 9:33605298-33605320 ACACACACACACACAGAGATTGG - Intergenic
1057747971 9:97766838-97766860 TCCCTCTCACACAATGAGCTGGG + Intergenic
1058136691 9:101315720-101315742 TCACAGACACACACAAAGCTGGG + Intronic
1058736571 9:107899561-107899583 ACACACACACACACAGAGTTTGG - Intergenic
1059076258 9:111196936-111196958 TCAGTCACACACAGAGACCCAGG + Intergenic
1060481296 9:124018036-124018058 GCACACACACACAAAAAGCTGGG - Intronic
1060829963 9:126707247-126707269 CCCCTCACACACAGAGAGCAGGG + Intergenic
1061299123 9:129694753-129694775 ACACACACACACACAGAGCTTGG - Intronic
1062023059 9:134328166-134328188 ACATCCACACACACAGAGCTAGG + Intronic
1186290303 X:8090192-8090214 ACACACACACACATACATCTTGG - Intergenic
1187746864 X:22418779-22418801 ACACACACACACAGAGAGTTGGG + Intergenic
1189615492 X:42778892-42778914 TCACTCACAGTCATTGAACTGGG + Intergenic
1190304891 X:49076324-49076346 GCACTCACACACAGAGAAATGGG - Intronic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1192583489 X:72303217-72303239 TCACCCCCACACATACACCTTGG - Intronic
1193236405 X:79112958-79112980 CAACTCACAATCATAGAGCTAGG + Intergenic
1193668144 X:84349673-84349695 ACACACACACACACAGGGCTAGG - Intronic
1194645957 X:96458511-96458533 ACACACACACACAAATAGCTAGG + Intergenic
1195419689 X:104660635-104660657 ACACACATACACATATAGCTGGG + Intronic
1195632881 X:107077600-107077622 ACACACACACAGATAAAGCTAGG + Intronic
1195750047 X:108155182-108155204 ACACTCATACACACACAGCTTGG + Intergenic
1196010885 X:110886966-110886988 ACACACACACACACACAGCTCGG - Intergenic
1196761888 X:119208300-119208322 GCACTCACAAACCTTGAGCTAGG + Intergenic
1196762228 X:119210465-119210487 GCACTCACAAACCTTGAGCTAGG + Intergenic
1196762244 X:119210584-119210606 GCACTCACAAACCTTGAGCTAGG + Intergenic
1197007994 X:121526574-121526596 TCACACACACACACACATCTTGG + Intergenic
1197712858 X:129684513-129684535 ACACACACACACACAAAGCTAGG - Intergenic
1198892339 X:141411818-141411840 TCATTCAGACACACAGAGTTTGG + Intergenic
1199739310 X:150718074-150718096 ACACACACACACACATAGCTGGG + Intronic
1200001242 X:153060862-153060884 TCACACACACTCACAGAGATGGG - Intergenic
1202254414 Y:22906226-22906248 TGACTCACATACACAAAGCTGGG + Intergenic
1202407405 Y:24539975-24539997 TGACTCACATACACAAAGCTGGG + Intergenic
1202463377 Y:25130106-25130128 TGACTCACATACACAAAGCTGGG - Intergenic