ID: 1081566406

View in Genome Browser
Species Human (GRCh38)
Location 11:44263780-44263802
Sequence ACACATAAGCTAGAGCTTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081566406_1081566417 28 Left 1081566406 11:44263780-44263802 CCCCCAAGCTCTAGCTTATGTGT 0: 1
1: 0
2: 1
3: 11
4: 110
Right 1081566417 11:44263831-44263853 GACACTGCTGAGCAGCCCCAGGG 0: 1
1: 0
2: 1
3: 21
4: 243
1081566406_1081566412 6 Left 1081566406 11:44263780-44263802 CCCCCAAGCTCTAGCTTATGTGT 0: 1
1: 0
2: 1
3: 11
4: 110
Right 1081566412 11:44263809-44263831 GTTGTGAGTCCTTCCATGCCGGG 0: 1
1: 0
2: 0
3: 15
4: 197
1081566406_1081566416 27 Left 1081566406 11:44263780-44263802 CCCCCAAGCTCTAGCTTATGTGT 0: 1
1: 0
2: 1
3: 11
4: 110
Right 1081566416 11:44263830-44263852 GGACACTGCTGAGCAGCCCCAGG 0: 1
1: 0
2: 3
3: 37
4: 287
1081566406_1081566411 5 Left 1081566406 11:44263780-44263802 CCCCCAAGCTCTAGCTTATGTGT 0: 1
1: 0
2: 1
3: 11
4: 110
Right 1081566411 11:44263808-44263830 AGTTGTGAGTCCTTCCATGCCGG 0: 1
1: 0
2: 0
3: 14
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081566406 Original CRISPR ACACATAAGCTAGAGCTTGG GGG (reversed) Exonic
900471511 1:2857236-2857258 ACACACAACCTCGTGCTTGGAGG - Intergenic
903047353 1:20574886-20574908 AAACATAAGCTGGATCTTGACGG - Intergenic
909862706 1:80629292-80629314 AGACATAATCTTGAGGTTGGGGG + Intergenic
910276332 1:85453135-85453157 ACACACAAGATATAGCTTGTTGG - Intronic
910559023 1:88569764-88569786 ATACATATTATAGAGCTTGGGGG - Intergenic
910762246 1:90745208-90745230 ACACAAAAGGGAGAGGTTGGAGG - Intergenic
916691316 1:167192702-167192724 ACCCATAAGCCATAGCTTGGTGG + Intergenic
921081058 1:211738697-211738719 AGACATAAGCTAAAGCTGGTGGG - Intergenic
922445623 1:225694617-225694639 ACACATAACCTTGGTCTTGGAGG - Intergenic
924110276 1:240692052-240692074 AGACAAAAGCTGGGGCTTGGCGG - Intergenic
924613315 1:245591552-245591574 GCACATGGCCTAGAGCTTGGGGG - Intronic
1062838564 10:652065-652087 CCACACAAGCTTGAGCTTTGTGG - Exonic
1065989154 10:30991115-30991137 AGACATAAGTCAGAGCTTGGAGG - Intronic
1067142834 10:43670700-43670722 ACATATCAGCTGGAACTTGGGGG - Intergenic
1069595481 10:69667269-69667291 ACACAGCAGCCAGAGCCTGGTGG - Intergenic
1069950328 10:72014303-72014325 ACACAGAAGCCAGAGCTGGTGGG + Intergenic
1070150772 10:73803533-73803555 ACACACAGGCTAAAGGTTGGGGG - Intronic
1071140133 10:82500111-82500133 AGGCATATGCTAGAACTTGGAGG + Intronic
1073007112 10:100333073-100333095 AAACAGAAGCTAGATCTTGATGG + Intergenic
1076056667 10:127380241-127380263 ACGTATAAGGTAGAGTTTGGTGG + Intronic
1076827877 10:132979027-132979049 ACACATGAGCAAGAACTTAGAGG + Intergenic
1078983549 11:16566122-16566144 CCACATAAGCAAAAGCTTTGGGG + Intronic
1081274405 11:41129979-41130001 AAACAGAATCTGGAGCTTGGTGG - Intronic
1081566406 11:44263780-44263802 ACACATAAGCTAGAGCTTGGGGG - Exonic
1085549871 11:77359137-77359159 ACACAAAGGTGAGAGCTTGGAGG - Intronic
1087071174 11:94082372-94082394 ACATAAAAGGTACAGCTTGGAGG - Intronic
1088836443 11:113581529-113581551 CTACAGAAGCTATAGCTTGGCGG - Intergenic
1089222845 11:116889525-116889547 TCACCTAAGCTAGAGCCTAGTGG - Intronic
1099083679 12:78218406-78218428 ACACAGAAGCCAGATTTTGGTGG + Intergenic
1099215019 12:79843090-79843112 AAACATACGCTACAGCATGGAGG - Intronic
1099472127 12:83063629-83063651 ATACATAAGAGAAAGCTTGGTGG + Intronic
1100454274 12:94736858-94736880 ACACAAAATCTAGAGGTAGGCGG - Intergenic
1104648205 12:130511962-130511984 TCACAGAAGCCTGAGCTTGGTGG - Intronic
1106538472 13:30669036-30669058 ACACAGAAGCCAGAGCTTATAGG + Intergenic
1111781944 13:92739527-92739549 ACACAGAAACCAGAGCTTGTGGG - Intronic
1119100869 14:71878923-71878945 ACACAAAAGCAAAAGTTTGGTGG - Intergenic
1123645255 15:22433309-22433331 ACACAGGACGTAGAGCTTGGAGG - Intergenic
1123733055 15:23162035-23162057 ACACAGGACGTAGAGCTTGGAGG + Intergenic
1125520704 15:40346433-40346455 ACACATAAGCCAGAGCAAGGTGG + Intergenic
1125879671 15:43183172-43183194 TCAAATAAGGTAGAGCTTGCTGG - Intronic
1126360574 15:47841693-47841715 ACAGAGAAGAAAGAGCTTGGGGG - Intergenic
1128990263 15:72253883-72253905 ACACATAAGATACACCTAGGAGG - Intronic
1132240980 15:100256852-100256874 ACACAGAAGCCAGGGCTTAGGGG - Intronic
1138479486 16:57292701-57292723 GCACAAAAGCTAGATCTTGCTGG - Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1143534910 17:7532271-7532293 TCACACAGGCTGGAGCTTGGTGG - Intergenic
1146340497 17:32015181-32015203 ACACAGAAGATAGGGATTGGGGG + Intronic
1146513836 17:33473529-33473551 ACACTTAAGGAAGAGCTTGCAGG + Intronic
1150749587 17:67847745-67847767 ACACAGAAGATAGGGATTGGGGG + Intronic
1150985662 17:70194418-70194440 ACACAAAAACTAGAGCTGGCTGG - Intergenic
1158212580 18:55067719-55067741 ACACAAAAGCCAGAGGTTGGAGG + Intergenic
1159093532 18:63875566-63875588 ATACAAAAGTTAGAGCGTGGTGG - Intronic
1163092694 19:15031955-15031977 AGACATAATCTTTAGCTTGGTGG + Intergenic
1166259746 19:41628836-41628858 AGACATATGTTAGAGCCTGGAGG + Intronic
928116083 2:28546013-28546035 TCACCTATGCTAGGGCTTGGAGG - Intronic
933388819 2:81645366-81645388 ACACATGAGCCAGAGTTTGGAGG + Intergenic
943081593 2:183264038-183264060 ACACATAAGCAAGGGCTTTGTGG + Intergenic
945100220 2:206256622-206256644 ACACATAGGCCAGGGGTTGGGGG + Intergenic
946815582 2:223575175-223575197 ACACATGAGCTAGACTTTGAAGG + Intergenic
1169052867 20:2595410-2595432 ACACACAAGCTAGAGTTTGGAGG - Intronic
1169590323 20:7133752-7133774 ACAGATAAGCCAGAACATGGAGG - Intergenic
1172476721 20:35244176-35244198 AAACAAAAGCTATAGCTAGGAGG + Intronic
1173287727 20:41688224-41688246 AGACATAAGCTAGAACATGTGGG - Intergenic
1173891656 20:46517072-46517094 ATACATAAGCTACATCCTGGTGG + Intergenic
1177449349 21:21245156-21245178 ACACAATAGCAAAAGCTTGGAGG - Intronic
1182504841 22:30774202-30774224 ACAAGGCAGCTAGAGCTTGGAGG - Intronic
951040394 3:17982892-17982914 ACACATAAGCAAAAGTTTGGTGG + Intronic
953194388 3:40718565-40718587 ACCCATATGCTAGTGCTTTGAGG + Intergenic
954792290 3:53142355-53142377 ACACATAAGCCTGACCTTGGAGG - Intergenic
955503142 3:59604934-59604956 ACCCATAAGTGAGAGCTGGGAGG + Intergenic
955846989 3:63174947-63174969 AAAAATTAGCCAGAGCTTGGTGG + Intergenic
958538531 3:95436281-95436303 ATACAAAAGCTAGAGGTTGAAGG - Intergenic
960855909 3:122102056-122102078 ACACATAATCAAGGGGTTGGTGG - Intronic
961464141 3:127071342-127071364 ACATTTAAGTTGGAGCTTGGAGG + Intergenic
962878823 3:139556964-139556986 GCACATAAGGTAGAGTCTGGAGG + Intergenic
963265161 3:143232777-143232799 ACATATAAACTAGAGGTTGCTGG - Intergenic
967765974 3:193279947-193279969 ACACAGAAGCTAGAGAGTGTTGG - Intronic
972869436 4:43279109-43279131 ACCCAAAAGCTAAAGCTTTGTGG + Intergenic
973648935 4:52978194-52978216 ATACAGAATCTGGAGCTTGGAGG + Intronic
976109192 4:81652844-81652866 ACACATAAACTAGTGTTTGATGG + Intronic
982808143 4:159791827-159791849 ATACATAAAATAAAGCTTGGAGG + Intergenic
987755286 5:22093170-22093192 ATAGATAAGCTAGAGCTTTGTGG - Intronic
989430162 5:41344940-41344962 ACTCATAATCTAGAGGTAGGTGG + Intronic
990948602 5:61275162-61275184 ACACATATCCAAGAGCATGGAGG - Intergenic
995425997 5:112023390-112023412 ACAAATAAGCTGGAGTCTGGTGG - Intergenic
995811148 5:116108541-116108563 ACCTAGAAGCTCGAGCTTGGTGG - Intronic
997613226 5:135229592-135229614 CCACCAAAGCCAGAGCTTGGAGG - Intronic
998066094 5:139160183-139160205 ACACAAAAGTTATAGCCTGGAGG + Intronic
998550814 5:143076283-143076305 ACAGAAAAGCTTGAGCATGGGGG - Intronic
998885105 5:146685895-146685917 ACATACAAGCTAGATTTTGGTGG - Intronic
1001472271 5:172022875-172022897 ACAAATTACCTAGAACTTGGTGG + Intergenic
1003506457 6:6744386-6744408 ACCCATAAGCTTGGGCCTGGTGG + Intergenic
1005815000 6:29543406-29543428 ACATATAAGCAAGTGCTTTGGGG - Intergenic
1006548977 6:34804648-34804670 AGACAGAAGCTAGATCATGGAGG + Intronic
1007299070 6:40852683-40852705 ACACAAAATCTTGAGTTTGGAGG + Intergenic
1008517340 6:52330461-52330483 ACACATAAACTGTATCTTGGGGG + Intergenic
1011145969 6:84217384-84217406 ACACGTGAGCTATGGCTTGGTGG + Intronic
1011548915 6:88511161-88511183 ACCCATAACCTCTAGCTTGGTGG + Intergenic
1011679919 6:89773252-89773274 ACACACAAGGCAGAGCATGGTGG + Intronic
1015599406 6:134897628-134897650 ACAGAAAAGCTGGAGCTTGCAGG + Intergenic
1021966226 7:25922016-25922038 ACACTTGAGCTAGATCTTGCAGG + Intergenic
1026848988 7:73713191-73713213 ACATCCAAGCTAGAGCCTGGTGG + Intronic
1031984636 7:128155711-128155733 TCACTGAAGCAAGAGCTTGGAGG - Intergenic
1033775616 7:144607150-144607172 ACAAATAACTTAGAACTTGGAGG + Intronic
1035390110 7:158497915-158497937 ACACATGAGCAGGAGCTGGGAGG + Intronic
1037160566 8:15766913-15766935 ACACATTAGCTGGAGCATGTAGG + Intergenic
1037505690 8:19527264-19527286 ACACCTCAGCTAGGTCTTGGAGG + Intronic
1039562101 8:38520691-38520713 ACGCCTTAGCTGGAGCTTGGGGG + Intronic
1039570057 8:38579513-38579535 GCACATAAGCAAAGGCTTGGGGG - Intergenic
1039919208 8:41881561-41881583 ACACAGAGCCTAGAGCTTGATGG - Intronic
1045432741 8:102128492-102128514 TCAGATGTGCTAGAGCTTGGTGG + Intergenic
1050372512 9:4936062-4936084 ACACATAGGGTAGAGGTTGTAGG - Intergenic
1050624794 9:7491425-7491447 ATGCATAAGCTAGATATTGGAGG - Intergenic
1053327637 9:37169908-37169930 ATACAAAAGATAGGGCTTGGTGG + Intronic
1055357094 9:75448800-75448822 GCACATAAGCAAGATCTTGGAGG - Intergenic
1056307596 9:85305352-85305374 ACTCATTGGCTGGAGCTTGGTGG - Intergenic
1058956580 9:109954372-109954394 GGACAGAAGCTAGGGCTTGGGGG - Intronic
1188249841 X:27878947-27878969 ACATATAACCTTGTGCTTGGTGG - Intergenic
1189830630 X:44969369-44969391 AGCCTTAAGTTAGAGCTTGGAGG + Intronic
1190323708 X:49193618-49193640 ACACACAAGCTCAAGCTGGGAGG - Intronic
1192387406 X:70685324-70685346 ACACCCAAGCTAGAGTGTGGTGG - Intronic
1197090960 X:122536731-122536753 ACAGCTAAGGTAGAGCTTGGGGG + Intergenic
1199837831 X:151611015-151611037 ACTGATAGCCTAGAGCTTGGGGG - Intronic