ID: 1081567028

View in Genome Browser
Species Human (GRCh38)
Location 11:44266351-44266373
Sequence CTGAGTTTAGGGAGGGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 598
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 547}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081567013_1081567028 21 Left 1081567013 11:44266307-44266329 CCAAGGAGGGAGCTAGAGTTCCA 0: 1
1: 0
2: 3
3: 16
4: 170
Right 1081567028 11:44266351-44266373 CTGAGTTTAGGGAGGGAGAGGGG 0: 1
1: 0
2: 2
3: 48
4: 547
1081567021_1081567028 -3 Left 1081567021 11:44266331-44266353 CCTGGGAGGACAGAGGGAGGCTG 0: 1
1: 0
2: 8
3: 89
4: 808
Right 1081567028 11:44266351-44266373 CTGAGTTTAGGGAGGGAGAGGGG 0: 1
1: 0
2: 2
3: 48
4: 547
1081567019_1081567028 1 Left 1081567019 11:44266327-44266349 CCATCCTGGGAGGACAGAGGGAG 0: 1
1: 0
2: 10
3: 164
4: 992
Right 1081567028 11:44266351-44266373 CTGAGTTTAGGGAGGGAGAGGGG 0: 1
1: 0
2: 2
3: 48
4: 547

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081567028 Original CRISPR CTGAGTTTAGGGAGGGAGAG GGG Intronic
900292500 1:1929405-1929427 GTGAGGGTAGGGAGGGAGCGAGG + Intronic
900740925 1:4330279-4330301 CTGGGTCTAGGGAGGGAAAAAGG + Intergenic
900954164 1:5876431-5876453 CTGAGCCTAGGGAGGGACCGAGG + Intronic
901300457 1:8196582-8196604 CTGAGTTTAGGCTGAGGGAGAGG - Intergenic
901364174 1:8731291-8731313 CGTATTTTAGGCAGGGAGAGGGG + Intronic
901646710 1:10720794-10720816 GTGAGCTGAGGGAGGGTGAGTGG + Intronic
901731696 1:11284810-11284832 ATTAGATTAGGGATGGAGAGGGG + Intronic
902188896 1:14746640-14746662 CTGGGGTCAGGGAGGGAGGGTGG + Intronic
902238744 1:15074405-15074427 CTGTGATCAGGAAGGGAGAGGGG + Intronic
902727545 1:18347165-18347187 CTGTGTTCAGAGAGGGAGGGAGG - Intronic
902791168 1:18769205-18769227 CTGAGCCAAGGGAGGGGGAGGGG - Intergenic
902984682 1:20148407-20148429 CTGAGGTTTGAGAGAGAGAGCGG + Exonic
903849651 1:26298108-26298130 CTGAGTTGTGGGGGGGAGGGAGG + Intronic
905715859 1:40149308-40149330 CTGAGTTTAGAGAGGGAGCAGGG + Intergenic
905808204 1:40892295-40892317 CTGAGTCCAGGGCTGGAGAGTGG + Intergenic
906713293 1:47948731-47948753 CTGAGGTTAAGGAGAGAGAAAGG - Intronic
907041004 1:51259309-51259331 CTGAGGTTAGAGAGGAAAAGGGG - Intronic
907098663 1:51806624-51806646 CTCCTTTTAGGGAGGGTGAGAGG + Intronic
907178588 1:52549868-52549890 ATGAGTTGAGGGAGAGAGAAGGG - Intronic
907436227 1:54450141-54450163 CTGAGTTAAGGTAGGGACTGTGG - Intergenic
908082436 1:60595689-60595711 CTGACTTTAAAGATGGAGAGAGG - Intergenic
908782300 1:67701444-67701466 CTGAGTGAAGGAAGGGAAAGGGG + Exonic
909261728 1:73498686-73498708 CTGATTTTAGGGAGGGGAGGCGG - Intergenic
910063884 1:83128832-83128854 TTGAGTTTATGAAGGGAGTGAGG - Intergenic
910158061 1:84242772-84242794 GCGTGTTTGGGGAGGGAGAGTGG - Intergenic
912470956 1:109906513-109906535 GTGACTTTAGGGAGGTAGAGAGG + Intergenic
912654854 1:111477114-111477136 GTGGGTTGAGGGAGGGGGAGAGG + Intronic
912990582 1:114482460-114482482 ATGAGTGCAGGGAGGGAGATGGG + Intronic
914792097 1:150887154-150887176 CTGAGTTCAGCGTGGGAGTGGGG + Intergenic
915464696 1:156089992-156090014 CTGCGGTGAGGGAGGGGGAGGGG + Intronic
915587439 1:156851865-156851887 GTGAGTGTAGGGAGGGTGGGGGG - Intronic
915974080 1:160373539-160373561 GTCATTTTAGGGAGGCAGAGGGG - Intergenic
916119293 1:161513356-161513378 GGGAGCTTAGGGAGGGAGAAAGG - Intronic
916129055 1:161595015-161595037 GGGAGCTTAGGGAGGGAGAAAGG - Intronic
916948121 1:169749780-169749802 CTGAGTAGAGGGAGGGAGATGGG + Intronic
917071039 1:171151115-171151137 CTAAGTTTCTGGAGGGAGAAAGG + Intronic
917745605 1:178003825-178003847 CTGTGTTTGTGGAGGGAGTGTGG + Intergenic
917990624 1:180374254-180374276 GTGAGTGTAAGGGGGGAGAGGGG - Intronic
918132649 1:181643280-181643302 CAGAGTTCAGAAAGGGAGAGGGG + Intronic
918733082 1:188022889-188022911 CTGGGGTCAGGGAGGGAGAGTGG + Intergenic
919946119 1:202320095-202320117 CTGAGTTGGGGCAGGGAGAAAGG + Intergenic
920176887 1:204107644-204107666 CTGTGCTTGGGGAGGGGGAGAGG + Intronic
920233164 1:204483624-204483646 GTGACTTTAGCGAGGGGGAGGGG + Intronic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920535358 1:206733515-206733537 CTGGGTTCCGGGAGGCAGAGAGG + Exonic
921383802 1:214550866-214550888 CTGCGTTTTGGGAACGAGAGAGG - Intronic
921399167 1:214701766-214701788 AAGGGTTTAAGGAGGGAGAGCGG - Intergenic
921555725 1:216596524-216596546 GGGAGTGCAGGGAGGGAGAGTGG + Intronic
922049993 1:221979571-221979593 GTTAGGTTAGGGAGAGAGAGAGG - Intergenic
922079256 1:222278945-222278967 TTGAGCTTAGGGAGGCAGAGGGG + Intergenic
922387334 1:225099948-225099970 TTGAGGCTAGGGTGGGAGAGGGG + Intronic
922689001 1:227672298-227672320 CTGAGTTAGGGGAGTGACAGTGG + Intronic
923254655 1:232211232-232211254 CTGAGAGGAGGGAGGAAGAGAGG - Intergenic
1062979440 10:1709777-1709799 TTGAGGTAAGGGAAGGAGAGGGG - Intronic
1064082654 10:12321051-12321073 CTTTGTTTGGGGAGGGTGAGGGG - Intergenic
1064325138 10:14343450-14343472 CTGAGCTCAGGGTGGTAGAGGGG - Intronic
1064500616 10:15968857-15968879 CTGAATTGAGGGAGGCAGAAAGG - Intergenic
1065156432 10:22874624-22874646 CTGGCTTTAGGGAAGAAGAGGGG - Intergenic
1065817530 10:29495601-29495623 CTGAGGGGAGGGAGGGACAGTGG + Intronic
1065955331 10:30688797-30688819 CTGAGGGGAGGGAGGGACAGTGG - Intergenic
1066574927 10:36814933-36814955 CTGAGTTTTGGGAGATAAAGAGG - Intergenic
1067441089 10:46309567-46309589 CTGTGTGGAGGGAGGAAGAGAGG + Intronic
1067488733 10:46677737-46677759 TGTAGTTCAGGGAGGGAGAGTGG - Intergenic
1067577737 10:47418830-47418852 CTGTGTGGAGGGAGGAAGAGAGG + Intergenic
1067605936 10:47662639-47662661 TGTAGTTCAGGGAGGGAGAGTGG + Intergenic
1068326257 10:55491563-55491585 AGGAGTTTAGACAGGGAGAGAGG + Intronic
1068565361 10:58568757-58568779 CTGAGTTGAGGGAAGGCAAGGGG - Intronic
1068852428 10:61759358-61759380 CTGACTTGGGGGAGGGAAAGGGG - Intronic
1069423286 10:68266531-68266553 CTGAATTTAGTGGGGGAAAGTGG + Intergenic
1070172565 10:73943679-73943701 CTTAGATTAGGGAGGGTGATTGG + Intergenic
1070324412 10:75378517-75378539 CTGGGCTGAGGGAGGGAGGGAGG - Intergenic
1070512090 10:77170642-77170664 TGGAGATTAGGGAAGGAGAGGGG - Intronic
1070624615 10:78041770-78041792 CTAAGTTGATGCAGGGAGAGTGG + Intronic
1071353144 10:84767017-84767039 CTGAGTATATGGATTGAGAGAGG + Intergenic
1071621491 10:87123993-87124015 TGTAGTTCAGGGAGGGAGAGTGG + Intronic
1072442746 10:95471415-95471437 CTGAGGTTAGGGTGGAGGAGGGG + Intronic
1073048346 10:100653164-100653186 CTGGGTTGGGCGAGGGAGAGGGG - Intergenic
1073152888 10:101323712-101323734 CTGAGTAGAGGGAGAAAGAGGGG - Intergenic
1073693115 10:105833865-105833887 CTGGGTTTAGTGAAGGAGAAAGG + Intergenic
1073875049 10:107913721-107913743 CTGAGCCTGGGGAGGGAGAGTGG - Intergenic
1074009557 10:109463301-109463323 CAGAGGTTAGGGATGGGGAGAGG + Intergenic
1074976975 10:118588775-118588797 GAGAGCTGAGGGAGGGAGAGAGG + Intergenic
1075274863 10:121084384-121084406 CTGGGTACAGGAAGGGAGAGGGG + Intergenic
1075304088 10:121352201-121352223 TACAGATTAGGGAGGGAGAGAGG - Intergenic
1076811324 10:132888082-132888104 CTGGGATGAGAGAGGGAGAGGGG - Intronic
1077472990 11:2773068-2773090 CTGCCTTAAGGGAGGGAGTGAGG - Intronic
1078282885 11:9920326-9920348 CTGAGCTTTGGCAGGGAGATAGG + Intronic
1078357579 11:10643741-10643763 CGGAGCTTAGGGAGGGAGGGAGG - Intronic
1078750965 11:14163468-14163490 CTGAGTTTAGGGAGGCTGACTGG - Intronic
1078928582 11:15895925-15895947 CTGTGTTCAGGGAGGGAGTGAGG + Intergenic
1078943131 11:16031797-16031819 AGGAGGTTAGGGAGGGAGAAAGG + Intronic
1078968844 11:16381775-16381797 TTGGGTTTTGGGAGGGAGTGGGG - Intronic
1079140077 11:17802745-17802767 CTGATTGAAGGGAGGGAGGGAGG - Intronic
1079671716 11:23179143-23179165 CTGAGTTTAAGAAGGAAGAATGG - Intergenic
1080890195 11:36402585-36402607 CTGATGATAGGGATGGAGAGAGG + Intronic
1081567028 11:44266351-44266373 CTGAGTTTAGGGAGGGAGAGGGG + Intronic
1083050460 11:59771857-59771879 CTGAGTTTAGGGAAGTTGATCGG + Intronic
1083363485 11:62127748-62127770 CTGTGTTTGGGCAGGGAGTGAGG + Intronic
1083596542 11:63920532-63920554 CTAAACTTGGGGAGGGAGAGAGG + Intergenic
1083938417 11:65882363-65882385 CTAAGTGGTGGGAGGGAGAGGGG + Intronic
1084912618 11:72403301-72403323 CTGATTTAAGGGAAGGAGAGAGG - Intronic
1085464553 11:76715063-76715085 CTGAGCTGAGAGAGGTAGAGGGG - Intergenic
1085831384 11:79904960-79904982 CTGAATTTAGAGATGGGGAGAGG - Intergenic
1087171974 11:95058410-95058432 GAGAGTTGAGGGAGGGAGGGAGG - Intergenic
1087425919 11:97985242-97985264 CTGAGGGCAGGGAGGGAGACAGG + Intergenic
1088559738 11:111101248-111101270 CTGGCTTTGGGGATGGAGAGAGG + Intergenic
1088689356 11:112311878-112311900 CTGAGTTTGGGGACTGAGATTGG - Intergenic
1088850496 11:113699823-113699845 CCCAGATTAGGGAGGGAGTGGGG + Intronic
1089176345 11:116551565-116551587 GTGAGTTGAGAGAGGGAGAGAGG - Intergenic
1089221012 11:116871670-116871692 CTGAGTTAAGGAAAGGAAAGTGG + Intronic
1089685104 11:120141700-120141722 CTGAGTTTGAGGCTGGAGAGGGG - Intronic
1089888121 11:121849633-121849655 CTTAGTTTGGGGAGAGAGTGAGG + Intergenic
1090443822 11:126746631-126746653 GTTAGGTGAGGGAGGGAGAGGGG - Intronic
1090452409 11:126818321-126818343 GTGATTTTAGGGAGGCAGTGTGG + Intronic
1090726454 11:129531303-129531325 ATGAGTTGAGGGAGAGAGATTGG - Intergenic
1091382391 12:70331-70353 CTCAGCTGAAGGAGGGAGAGAGG - Intronic
1091816963 12:3446065-3446087 CTGAGGGTGGGGAGGGGGAGTGG - Intronic
1092226677 12:6752724-6752746 CTGAGTGTAAGGAGGGGGCGGGG - Intronic
1092367037 12:7884878-7884900 CTGAGGGTAGGGTGGGAAAGAGG + Intronic
1092656696 12:10692561-10692583 CTGAGTTTTGGGAGAGACAAGGG - Intergenic
1092719283 12:11425000-11425022 GTGCATTTATGGAGGGAGAGTGG - Intronic
1093078573 12:14783157-14783179 CAAAGTTTAGGCAGGAAGAGGGG - Intergenic
1095962337 12:47843664-47843686 CAGAGTGTGGGAAGGGAGAGCGG - Exonic
1096096440 12:48938641-48938663 CTGGGTTTCGGGAGGTCGAGTGG - Exonic
1096718195 12:53503359-53503381 CCTGGGTTAGGGAGGGAGAGGGG + Intronic
1096899877 12:54865977-54865999 GTGGGTTTAGGGATGCAGAGAGG + Intergenic
1097029958 12:56083002-56083024 CTGAGTTTAGGAAGGCGGGGAGG + Intronic
1097123668 12:56755564-56755586 CTGAGGAGAGGGAGAGAGAGAGG + Intronic
1097168551 12:57099114-57099136 CTGGGGTTAGGGAGGAAGGGAGG + Intronic
1098819266 12:75208369-75208391 GTGTGTTTGGGGAGGCAGAGAGG - Intronic
1099047260 12:77737102-77737124 CTCAGATGAGGGAGGCAGAGGGG + Intergenic
1099395092 12:82128677-82128699 ATAAGCTAAGGGAGGGAGAGAGG - Intergenic
1099782481 12:87215314-87215336 CTGAGTTAAGTGAGGGTGGGAGG - Intergenic
1100866002 12:98857429-98857451 TTGAGCTTGAGGAGGGAGAGTGG + Intronic
1101008895 12:100430012-100430034 ATAAGTATGGGGAGGGAGAGAGG - Intergenic
1101643115 12:106602697-106602719 CTGAGTTTAGTGAGGGAGCAAGG - Intronic
1101883588 12:108642385-108642407 GTGAGTTTAGAGAGGCAGATGGG - Intergenic
1101941953 12:109105891-109105913 CTGATTTCAGGGGGGTAGAGGGG + Intronic
1102348651 12:112175972-112175994 CAGAGTTACGGGAGGGAGAGGGG - Intronic
1102431051 12:112883059-112883081 CTTAGTGCATGGAGGGAGAGGGG + Intronic
1102566985 12:113803324-113803346 CTGGGTCTGGGGAAGGAGAGTGG - Intergenic
1103248312 12:119477471-119477493 CTGAGTCTAGTGGGGGAGATGGG - Intronic
1103971310 12:124674454-124674476 CTGGGAGGAGGGAGGGAGAGAGG - Intergenic
1104608185 12:130205123-130205145 CTAAGTTTATGGAGGGCGGGAGG + Intergenic
1105756657 13:23471155-23471177 CTGAGTATAGGAAGCAAGAGAGG + Intergenic
1106505949 13:30370603-30370625 GTGTGTTTAGGGAGGTAGATGGG - Intergenic
1107826392 13:44332405-44332427 ATGAGTCTGGGAAGGGAGAGTGG + Intergenic
1108736287 13:53286461-53286483 CTCCTTTGAGGGAGGGAGAGAGG + Intergenic
1108945685 13:56019851-56019873 CTGAGTTTGGGCAGGCAGTGGGG + Intergenic
1109371374 13:61424460-61424482 TTGAATTTGGGGAAGGAGAGAGG + Intronic
1111010241 13:82303358-82303380 GAGAGTGGAGGGAGGGAGAGGGG + Intergenic
1111262957 13:85766750-85766772 CTGAGTTTGGGTAGGGAGGGAGG + Intergenic
1111391442 13:87600669-87600691 GTGAGTTTTGGAAGGGTGAGGGG + Intergenic
1113615566 13:111678149-111678171 ATGTGTTGAGAGAGGGAGAGAGG - Intergenic
1113621034 13:111763051-111763073 ATGTGTTGAGAGAGGGAGAGAGG - Intergenic
1113648983 13:112020775-112020797 CTGAGTAGAGGGAGAGAGACTGG - Intergenic
1114446729 14:22794328-22794350 CTGAGTTCCAGGAAGGAGAGCGG - Intronic
1114989989 14:28274473-28274495 CTGAGCTTAGGGAGAGACAGAGG - Intergenic
1115003050 14:28444133-28444155 CTGTGTGTGGGGGGGGAGAGGGG + Intergenic
1115508407 14:34115269-34115291 CTGGGATGAGGTAGGGAGAGTGG - Intronic
1115804756 14:37038393-37038415 CTGAGTTTGGGAAAGGGGAGAGG - Intronic
1116845772 14:49863521-49863543 CTTAGGTTAGGAAGGGATAGAGG + Intergenic
1118331927 14:64821935-64821957 CTGAGTACAGGGAGGGAGTGGGG + Intronic
1118443257 14:65830583-65830605 CTGTGCTTTGGGAGAGAGAGAGG + Intergenic
1118471592 14:66079716-66079738 CATAGTTTGGGGAGGGAGAGTGG - Intergenic
1118563498 14:67113670-67113692 CTATCTTTAGGGAGAGAGAGAGG - Intronic
1118949806 14:70425841-70425863 CTAAATTTAGAGAGGGAAAGAGG + Intergenic
1119389998 14:74284763-74284785 CTGACATGAGGGAGGGATAGAGG + Intergenic
1119676987 14:76563187-76563209 CAGAGTTCTGGGTGGGAGAGGGG - Intergenic
1121013247 14:90534049-90534071 CTGAGTCCAGGGAGGGACAGTGG + Exonic
1121092800 14:91194498-91194520 CTGAGGTTAGGGAGGGGGGATGG + Intronic
1121646621 14:95522157-95522179 CAGAGTTTAAGGAGGGAATGGGG - Intergenic
1121832822 14:97066556-97066578 ACGAAATTAGGGAGGGAGAGAGG - Intergenic
1122010526 14:98742698-98742720 CACAGTCTAGGGAGGGAGACAGG - Intergenic
1122412623 14:101533731-101533753 GTGTGGTGAGGGAGGGAGAGTGG + Intergenic
1122629094 14:103099251-103099273 CTGGCTTTAGGTTGGGAGAGGGG - Intergenic
1122972014 14:105156198-105156220 CTGCGTTTAGGGTGGGAGCGGGG - Intronic
1125514354 15:40309457-40309479 CAGACTGGAGGGAGGGAGAGAGG - Intergenic
1125760793 15:42094271-42094293 CTGAGATTTGGGATGCAGAGTGG - Intronic
1126317534 15:47386496-47386518 CTGGCTTCAGGGAAGGAGAGGGG + Intronic
1127249797 15:57220886-57220908 CTTAGTGAAGGGGGGGAGAGGGG + Intronic
1127419874 15:58794611-58794633 AGGAGTTTAGGGAGGAAGTGGGG + Intronic
1127859519 15:62981495-62981517 CTGAGAGTAGGAATGGAGAGAGG - Intergenic
1128543766 15:68554143-68554165 CTGAGTATGGGGAGACAGAGAGG + Intergenic
1128944247 15:71810624-71810646 CAGAGTTCAGGAAGGGAGACAGG + Exonic
1129567865 15:76643164-76643186 CTGATGTGAGGGAGGGAGACAGG - Intronic
1129597154 15:76974035-76974057 GTGAGATTAGGGTAGGAGAGTGG + Intergenic
1130986998 15:88851118-88851140 CTGAGTTCACGGAGGGTCAGGGG - Intronic
1131462166 15:92625149-92625171 CAGAGTTTGGGGAGGGAGGGAGG - Intronic
1131530839 15:93190438-93190460 CTGTGTGTGGGGAGGGTGAGAGG - Intergenic
1131748089 15:95471798-95471820 CTGGCTTTAGGGAGGGAGAGAGG - Intergenic
1133151364 16:3834512-3834534 CAGGGTTTTGGGAAGGAGAGAGG + Intronic
1133468314 16:6049464-6049486 ATGAGACTAGAGAGGGAGAGTGG - Intronic
1134114665 16:11539023-11539045 CTCAGCTCAGGGAGGGAGGGAGG + Intergenic
1134183412 16:12065049-12065071 CTGAGTGTTGGGAGGGAGAAAGG + Intronic
1134504001 16:14790798-14790820 CTGAGGTCAGGGAGGGAGGCAGG + Intronic
1134576571 16:15338110-15338132 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1134725868 16:16418389-16418411 CTGAGGTCAGGGAGGGAGGCAGG + Intergenic
1134772227 16:16819300-16819322 TTGAGGGGAGGGAGGGAGAGAGG - Intergenic
1134941565 16:18293470-18293492 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1134978631 16:18590102-18590124 CTAAGGTGAGGGAGGGAGGGAGG - Intergenic
1135016516 16:18928284-18928306 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1135586129 16:23672497-23672519 CTGTGTTTTGGTAGGGAGGGAGG + Exonic
1136333633 16:29597264-29597286 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1137236819 16:46624180-46624202 CAGGGCTTAGGGAGGGAGGGAGG - Intergenic
1138488848 16:57364356-57364378 CTGCCTTTTGGCAGGGAGAGGGG - Exonic
1138774356 16:59703674-59703696 GTGGGTTTATGGAGGGAGAAAGG - Intergenic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1142050336 16:87953931-87953953 GAGCGTTCAGGGAGGGAGAGGGG - Intronic
1142095607 16:88237798-88237820 CAGAGTGCAGGGAGGGTGAGTGG - Intergenic
1142611808 17:1112590-1112612 CTGTCTTGAGGGAGGGAGGGAGG + Intronic
1142656632 17:1399267-1399289 CTGAGGAAAGGGAGGGAGTGAGG + Intronic
1143016598 17:3893864-3893886 CTGAGCTAAGGGAGGGGAAGTGG - Intronic
1143500383 17:7335363-7335385 AGGAGTTCAGAGAGGGAGAGTGG + Intergenic
1143798758 17:9359933-9359955 CTGTGCTTTGGGAGGGACAGAGG + Intronic
1144776764 17:17788733-17788755 CTGAGGGGAGGCAGGGAGAGAGG - Intronic
1145208599 17:20997296-20997318 CTGAGGTGAGGGAGGGCGTGAGG + Intergenic
1145837498 17:27965633-27965655 CTGAGTTGAAGGAAGGAGAGAGG - Intergenic
1146393710 17:32444851-32444873 CTCAGCGTAGGGTGGGAGAGTGG + Intronic
1146890815 17:36505421-36505443 ATGGGGTTAGGCAGGGAGAGGGG + Intronic
1147614443 17:41819903-41819925 CCAAGTTTGGGGAGGGAGGGTGG + Intronic
1147919024 17:43905399-43905421 CTGAGCTAAGAAAGGGAGAGAGG - Intronic
1147978852 17:44262608-44262630 CCCAGCTGAGGGAGGGAGAGGGG + Intronic
1148708655 17:49659848-49659870 CTGAGATGAGGGTGGGAGATAGG - Intronic
1148768185 17:50051556-50051578 CAGGGCTGAGGGAGGGAGAGAGG - Intergenic
1150656688 17:67044250-67044272 CTGAGTTGGGAGAGGGCGAGAGG - Intergenic
1150657965 17:67053048-67053070 CTGAATTTGATGAGGGAGAGGGG - Intronic
1151311038 17:73292564-73292586 CTCAGTATAAGGAGGGAAAGGGG + Intronic
1151747269 17:76018300-76018322 CTGGGGCTGGGGAGGGAGAGAGG - Intronic
1151882928 17:76905675-76905697 CTGGGTGGAGGGAGGGAGGGAGG - Intronic
1151949348 17:77341346-77341368 CTGAGCAGAGGGAGAGAGAGCGG + Intronic
1152077074 17:78166461-78166483 CTGGGTGTAGGGAGAGGGAGGGG + Intergenic
1152214243 17:79023369-79023391 CAGAGTCTAGGGATGGAGACTGG + Intronic
1152466338 17:80468654-80468676 GTGTGTTTGGGGAGGGGGAGAGG + Exonic
1152491887 17:80640601-80640623 CTGAGTCAGGGCAGGGAGAGTGG + Intronic
1153101321 18:1473215-1473237 CAGAGAGTGGGGAGGGAGAGAGG + Intergenic
1153683706 18:7524965-7524987 CAGAGCTGGGGGAGGGAGAGGGG - Intergenic
1153690218 18:7585005-7585027 TGGAAATTAGGGAGGGAGAGAGG + Intronic
1155096121 18:22558200-22558222 CTGAGTTTAAGGATGGGGGGTGG + Intergenic
1156450207 18:37262484-37262506 TGGAGTGTAGGGTGGGAGAGGGG + Intronic
1156512873 18:37655753-37655775 CTGAGTTGAGAGAAGGAGAAGGG - Intergenic
1156614878 18:38771880-38771902 CTGTGTTGTGGGACGGAGAGGGG - Intergenic
1157344627 18:46814636-46814658 TTGAGTATAGGGAGGGATAGAGG - Intronic
1157558414 18:48628808-48628830 CTGAGATTTGAGAGAGAGAGAGG - Intronic
1157608239 18:48939662-48939684 CTCAGTTTAGGGTGGGAGGAAGG - Intronic
1158037254 18:53048267-53048289 CTGAGTGGAGGGTGGGAGAAGGG - Intronic
1159065206 18:63561886-63561908 CTTGGGTCAGGGAGGGAGAGAGG + Intronic
1159684614 18:71402590-71402612 GTGAGGTTAAGGAGGGAAAGAGG - Intergenic
1159908445 18:74119795-74119817 CTGAGGTGGGGGAGGCAGAGTGG + Intronic
1160347888 18:78149855-78149877 CTGAGGAGAGGGAGGGAGATGGG + Intergenic
1160429268 18:78800365-78800387 ATGAGTGCAGGGAGGGAGTGAGG - Intergenic
1160429277 18:78800404-78800426 GTGAGTGCAGGGAGGGAGTGAGG - Intergenic
1160429286 18:78800443-78800465 GTGAGTGCAGGGAGGGAGTGAGG - Intergenic
1160429295 18:78800482-78800504 ATGAGTGCAGGGAGGGAGTGAGG - Intergenic
1160429304 18:78800521-78800543 GTGAGTGCAGGGAGGGAGTGAGG - Intergenic
1160429313 18:78800560-78800582 ATGAGTGCAGGGAGGGAGTGAGG - Intergenic
1160429322 18:78800599-78800621 ATGAGTGCAGGGAGGGAGTGAGG - Intergenic
1160779528 19:871742-871764 TTGTGTTTTGGTAGGGAGAGGGG + Intronic
1161142248 19:2654629-2654651 CTGAGTGGGGGGAGGGAGAGAGG + Intronic
1162171182 19:8790248-8790270 CTGAGGGGAGGGAGGGAGGGAGG + Intergenic
1162481225 19:10928214-10928236 CTGAGTTCAGGGCGGGGGCGGGG + Intronic
1162751444 19:12832506-12832528 CTGAGATTAGGGAAGGAGAAAGG - Intronic
1163448293 19:17360604-17360626 CTGGGTCTGTGGAGGGAGAGAGG + Exonic
1164706429 19:30323457-30323479 CTAAGTGTATGCAGGGAGAGGGG + Intronic
1164707314 19:30329675-30329697 CTGGGTGCAGAGAGGGAGAGGGG - Intronic
1164857616 19:31537274-31537296 CTGGGTTATGGGAGGGTGAGAGG - Intergenic
1165382987 19:35494273-35494295 CTGGGTCTAGGGAGGGAGTGGGG + Intronic
1165501730 19:36194827-36194849 CTGGGTCAAAGGAGGGAGAGAGG - Intronic
1165792521 19:38500580-38500602 GGGAGTAGAGGGAGGGAGAGGGG - Intronic
1165953673 19:39488880-39488902 TTGAGATTAGGCTGGGAGAGGGG + Intronic
1166108906 19:40611096-40611118 CAGAGGTCAGGGAGGCAGAGGGG + Intronic
1167108448 19:47445057-47445079 ATGCTTTGAGGGAGGGAGAGAGG - Intronic
1167288994 19:48614481-48614503 CTGAGGCTTGGGAGGGAGACAGG - Intronic
1167456456 19:49598834-49598856 CTGGGTTTAGGGAGAGAGGCAGG + Intronic
1167750164 19:51374631-51374653 CTGAGTTTGGGGATGGAGTTGGG - Intergenic
1167792749 19:51691325-51691347 CGGAGGTGAGGGATGGAGAGAGG + Intergenic
925334034 2:3080125-3080147 ATGAGTTTGGGGGTGGAGAGAGG + Intergenic
925597581 2:5571151-5571173 CTGAGTGAACGGAGGGAAAGAGG - Intergenic
926155281 2:10449970-10449992 CGGACTAGAGGGAGGGAGAGGGG + Intergenic
926743305 2:16129947-16129969 CTGAGTCTTGGGAGGGATGGCGG - Intergenic
926777357 2:16435704-16435726 CAGAGTTAGGGGAGGGAGAATGG - Intergenic
926798073 2:16635219-16635241 CTCTGTTAAGGGAGGAAGAGGGG - Intronic
927503461 2:23597782-23597804 CTCAGTCTAGGGAAGGAGATGGG + Intronic
928028141 2:27756315-27756337 CTGACTGTGGGGAGGGAGAGGGG - Intergenic
928268755 2:29835553-29835575 CTGGGTTGGGGAAGGGAGAGTGG - Intronic
929351511 2:40961671-40961693 GTGAGTTTAGGGAATCAGAGAGG + Intergenic
930166757 2:48210682-48210704 TTGAGTTTTGGGGGGGACAGAGG - Intergenic
930171305 2:48254484-48254506 CTGAGAATAAGGAGGGGGAGAGG + Intergenic
930441620 2:51415353-51415375 TTGAGTTTAGGGAGGGCAAGTGG - Intergenic
932477153 2:72013458-72013480 CTGAGGCTAGGGAGAGACAGAGG + Intergenic
932510526 2:72283650-72283672 CTGAGTCTCAGCAGGGAGAGGGG + Intronic
933286678 2:80391876-80391898 GTGAGTTTAGGGAGTGGGAAAGG + Intronic
934061654 2:88299844-88299866 CTGAGGAGAGGGAGAGAGAGAGG - Intergenic
934555098 2:95282918-95282940 CTGTGTTTGGGGAGGGCGAGGGG - Intronic
935009891 2:99124490-99124512 CTGTGTTGAGGAAGAGAGAGAGG - Intronic
935163572 2:100549992-100550014 CTGAGAATGGGGAGAGAGAGAGG + Intergenic
935929088 2:108104049-108104071 AAGAGTTTAGGGAAGAAGAGTGG + Intergenic
935956389 2:108380832-108380854 CTGAGTTTTGGAAGGCAGTGGGG - Intronic
936072114 2:109378073-109378095 ATGTGTTCAGGGAGGAAGAGGGG + Intronic
936392274 2:112086436-112086458 CTGAGTGTTGGAAGAGAGAGTGG + Intronic
936528700 2:113259897-113259919 CTGCGTTTGGGGAGGGAAACAGG + Intronic
936810004 2:116386672-116386694 CTGAGTGGAAGAAGGGAGAGAGG + Intergenic
937261803 2:120591383-120591405 CTGGGCCTAGAGAGGGAGAGGGG - Intergenic
937355113 2:121193290-121193312 CTGAGTTAATGGAGGGCCAGAGG + Intergenic
937391183 2:121488075-121488097 CTGAGTTTAGGGCTGGAGCAAGG - Intronic
937705682 2:124918181-124918203 CTGAGAAAAGGGAAGGAGAGGGG - Intergenic
937854434 2:126662094-126662116 CAGAGTTCAAGGAGGAAGAGTGG - Intronic
938239492 2:129732418-129732440 CTGACTTTACGGAGGAGGAGGGG - Intergenic
938562544 2:132487078-132487100 CTGAGGATAGGGAGAGAGATGGG + Intronic
939588231 2:144031504-144031526 CTGAATTTTGGAAGGAAGAGCGG + Intronic
939671244 2:145015367-145015389 CAGGGTAGAGGGAGGGAGAGGGG - Intergenic
939707007 2:145467501-145467523 CTGAGTTTAGGCAGAGATAATGG - Intergenic
940800944 2:158131716-158131738 CTCAGATTAGGCAGGGAGGGTGG - Intronic
941650832 2:168090803-168090825 ATGAGTATAGGGAGGCTGAGGGG + Intronic
942308381 2:174631018-174631040 TTGTGTTTTGGGAGGAAGAGTGG + Intronic
944096586 2:195975283-195975305 CTGTTCTCAGGGAGGGAGAGTGG + Intronic
944480831 2:200155667-200155689 CTGATTTTTGGAAGGGAGAATGG + Intergenic
945505641 2:210637148-210637170 CTAAATTTAGAGAGGGAGAGAGG + Intronic
946081259 2:217120636-217120658 CTGAGCTTAGGGAGCGGAAGAGG + Intergenic
946259136 2:218470948-218470970 CATATTTGAGGGAGGGAGAGAGG + Intronic
947004585 2:225496230-225496252 CTGAGGTTACAGAGGGAGTGAGG + Intronic
947158621 2:227189107-227189129 GTGAGTGTCTGGAGGGAGAGAGG + Intronic
947342313 2:229152861-229152883 TTGGGTTTGGGGAGGGAAAGAGG - Intronic
947372836 2:229466083-229466105 CTGTGTTTAGGGGGGAAGAATGG - Intronic
1168764219 20:371095-371117 CTGAGTCAGGGCAGGGAGAGAGG - Intronic
1169596817 20:7209885-7209907 CTGAGGTTAGAGAGGAAAAGAGG + Intergenic
1170477180 20:16727142-16727164 CTGAATTGGGGGTGGGAGAGTGG + Intergenic
1170848664 20:19983819-19983841 ATGAGGTTAGGGTGGGAGGGAGG - Intronic
1171298592 20:24040041-24040063 GGGATTTTAAGGAGGGAGAGTGG - Intergenic
1171333782 20:24364533-24364555 CTTTGTTGAGGGAGGGAGGGTGG + Intergenic
1172626903 20:36352527-36352549 CTGAGTGTGGGGCGAGAGAGAGG + Intronic
1172845878 20:37929785-37929807 CTGAATGTGGGAAGGGAGAGTGG + Intronic
1173451864 20:43171917-43171939 CTGAGTTTAGTGATGGAGTTTGG - Intronic
1175081015 20:56420272-56420294 GTGGGGTTAGGGAGGGACAGGGG + Intronic
1175374593 20:58515447-58515469 ATGAGATTTGGGAGGGAGGGGGG - Intergenic
1175404949 20:58719890-58719912 CTGATTTAAGGGAGGCAAAGGGG - Intergenic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175454118 20:59096976-59096998 TTGCATTTGGGGAGGGAGAGAGG + Intergenic
1175619326 20:60430331-60430353 CTTTGCTAAGGGAGGGAGAGAGG - Intergenic
1176118559 20:63444007-63444029 CAGCGTCCAGGGAGGGAGAGGGG + Intronic
1176282812 20:64324503-64324525 CTCAGCTGAAGGAGGGAGAGAGG + Intergenic
1176292317 21:5052715-5052737 ATGAATGGAGGGAGGGAGAGAGG - Intergenic
1176295682 21:5070897-5070919 CTGAGTCTATGGATGGAGGGAGG + Intergenic
1176980409 21:15375343-15375365 CTGAGTTGAGGCATGTAGAGTGG - Intergenic
1178103439 21:29294560-29294582 CTGAGGTTAGGGAGGAGGACAGG + Intronic
1178397137 21:32252638-32252660 CTTAGTTAAGTGAGGGAGAAAGG - Intergenic
1178929025 21:36800908-36800930 CTTAGTTGAGGGGCGGAGAGAGG + Intronic
1179080494 21:38166325-38166347 CTGGCTTCAGGGAGGGTGAGGGG - Intronic
1179524092 21:41964425-41964447 CTGAGATGAAGGAGGGAAAGTGG + Intergenic
1179861365 21:44191227-44191249 CTGAGTCTATGGATGGAGGGAGG - Intergenic
1179864943 21:44210943-44210965 ATGAATGGAGGGAGGGAGAGAGG + Intergenic
1179925449 21:44531699-44531721 CTCAGTGGAGGGAGGGTGAGTGG - Intronic
1180087617 21:45515020-45515042 CTGCCCTTAGGGTGGGAGAGAGG + Exonic
1181390021 22:22573507-22573529 CTTAGATTTGGGAGGGAAAGAGG + Intergenic
1181532982 22:23527649-23527671 CTGGGTGGAGGGAGGGAGTGAGG + Intergenic
1181956142 22:26589439-26589461 CGGAGTTTACGGAGGGAGGTTGG + Intronic
1181998881 22:26903993-26904015 CTGAGCTTAGCTAGGAAGAGGGG - Intergenic
1182013900 22:27023026-27023048 CTGGGGCTAGGGAGGGAGGGAGG + Intergenic
1182435592 22:30327354-30327376 GTGAGTTCAGGGACGCAGAGCGG + Intergenic
1182528587 22:30937750-30937772 CTGAATGTAGGGAGAGAGAGAGG - Intronic
1183362345 22:37389314-37389336 GTGAGCTTAGAGAGGGAGAGAGG - Intronic
1183520374 22:38293323-38293345 TTGAGGGTGGGGAGGGAGAGAGG + Intronic
1183827963 22:40403455-40403477 CTCATTTTAGTGAGGGAGACAGG + Intronic
1184105088 22:42362798-42362820 CAGAGCACAGGGAGGGAGAGGGG + Intergenic
1184416291 22:44353622-44353644 CTGAGAATAGAGAGGGGGAGAGG - Intergenic
1185384890 22:50527073-50527095 CTGAGTGGAGGGAGGCAGTGGGG + Intronic
949232159 3:1763100-1763122 CTTAGAGTGGGGAGGGAGAGAGG + Intergenic
949577842 3:5356052-5356074 CTGGGATTAGGGATGGAGACTGG - Intergenic
949687970 3:6599923-6599945 TTAAGTATAGGAAGGGAGAGAGG + Intergenic
949744450 3:7272149-7272171 GTGGGGTTACGGAGGGAGAGAGG - Intronic
949907306 3:8868953-8868975 CTTAGTTCAGGGAGGAAAAGGGG - Intronic
950156272 3:10723765-10723787 CTGAGTGTTGGGAAGGAGGGTGG + Intergenic
950167736 3:10814544-10814566 CTGAATTTAAGGAGAGAGAAAGG + Intergenic
950482999 3:13256183-13256205 CTGAGTCTAGAGACGGATAGTGG + Intergenic
951710386 3:25580746-25580768 ATGGGTCTGGGGAGGGAGAGAGG + Intronic
952262928 3:31758129-31758151 CTGAGATTAAGAAGGGTGAGGGG - Intronic
953937932 3:47062571-47062593 CTGAGTCTTTGGAGGGAAAGAGG - Intronic
954185084 3:48910792-48910814 CTGAGTAAATGGAGAGAGAGTGG + Intergenic
954364302 3:50138127-50138149 CTGAAGTCAGGCAGGGAGAGAGG - Intergenic
954476258 3:50749037-50749059 CTTAATTTTGGGAGGGAGGGAGG - Intronic
954671191 3:52292155-52292177 CTGAGTTGGGGGAGGGTGTGTGG + Intronic
954678476 3:52328325-52328347 CTGGGTGGAGGGATGGAGAGTGG - Intronic
954746813 3:52792074-52792096 CTGATTTTGGGGAGGGAGGATGG + Intergenic
954754659 3:52832626-52832648 AAAAGTGTAGGGAGGGAGAGGGG + Intronic
954775293 3:53011744-53011766 CTGAGGTTTGGGAGTGAGGGAGG + Intronic
954966703 3:54617860-54617882 CTCAGTGAAGGGAGGGACAGGGG - Intronic
954993738 3:54863402-54863424 CTGAAAGCAGGGAGGGAGAGTGG - Intronic
956379966 3:68654867-68654889 CTGAGTTTGGGGGGGGCGGGGGG + Intergenic
956785775 3:72641085-72641107 CTGAGTTTGGAGAGGAAGAGAGG + Intergenic
957037717 3:75310507-75310529 CTGAGTGTTGTCAGGGAGAGGGG + Intergenic
957188905 3:76980839-76980861 CTAAGGCTGGGGAGGGAGAGAGG - Intronic
957743762 3:84310369-84310391 TTGTTTTTGGGGAGGGAGAGGGG - Intergenic
958091290 3:88879955-88879977 CTGACCTTTGTGAGGGAGAGAGG + Intergenic
958888211 3:99752869-99752891 CTCAGTTTAGAGGGGGAGAAGGG + Intronic
959062597 3:101629435-101629457 CTGTGCTTAGGGAGGTAAAGAGG + Intergenic
959591773 3:108090429-108090451 TGGGGTTGAGGGAGGGAGAGTGG - Intronic
960936161 3:122904204-122904226 ATGGGGTCAGGGAGGGAGAGAGG - Intergenic
961085752 3:124066060-124066082 CTGAGTGTTGTCAGGGAGAGGGG + Intergenic
961518213 3:127451557-127451579 CTGAGTTAAGGGTGGGGCAGGGG + Intergenic
961645440 3:128390414-128390436 CTGTATTTTGGGAGGTAGAGGGG + Intronic
961749938 3:129088877-129088899 CAGGGCTTAGGGAGGGAGGGAGG - Exonic
962533591 3:136306002-136306024 CTAATTTTAGGGAGGGTGATGGG - Intronic
962909226 3:139832549-139832571 GTGAGTTGTGGGAGTGAGAGAGG - Intergenic
963591719 3:147269431-147269453 CTGAGGTTAGGGGAGGAGTGAGG - Intergenic
964281016 3:155065290-155065312 CTTAGTCTAGTAAGGGAGAGAGG - Intronic
964661970 3:159130082-159130104 CAGAGGTTAGGGATGGGGAGGGG - Intronic
966565374 3:181374907-181374929 GTGACTTTAGGTAGGGAGATTGG + Intergenic
967242015 3:187448746-187448768 CTGATTTGTGGGAGGGAGAAAGG - Intergenic
967293805 3:187946705-187946727 GTGAGTTTAGGGAGGCAGGCAGG + Intergenic
967467129 3:189820536-189820558 TTGAGTTTAGGGGTGGAGATAGG + Intronic
967489935 3:190078862-190078884 CTTAGTTAAGGGTGGAAGAGTGG + Intronic
967931948 3:194696318-194696340 ATGAGTTCAAGGAGGGAGGGTGG + Intergenic
969675655 4:8613020-8613042 CTGGGTTCTGGAAGGGAGAGAGG - Intronic
969705059 4:8787193-8787215 GGGAGTTAAGGGAAGGAGAGAGG + Intergenic
969942724 4:10750746-10750768 TTGAAGTTAGAGAGGGAGAGGGG + Intergenic
970556882 4:17242866-17242888 CTGAGTGTGGGGAGGAAAAGGGG - Intergenic
970597737 4:17615296-17615318 TGGAGGTTAGGGAGGGAGGGAGG + Intronic
973180213 4:47257548-47257570 GTGGGTGTAGGGAGGGAGGGTGG + Intronic
973189686 4:47372902-47372924 GTGAGTATGGGGAGGGAGTGAGG - Intronic
973875890 4:55218113-55218135 CTGATTTTGAGGAGGGAGACCGG - Intergenic
974260326 4:59518115-59518137 CTGAGGTTGGGGAGGGACTGAGG - Intergenic
974288349 4:59897969-59897991 CTGGGTTTGGGGTGGGGGAGGGG + Intergenic
974479484 4:62424576-62424598 TTGAGTTAATGGATGGAGAGAGG - Intergenic
975683755 4:76899687-76899709 CTGGGTTGAGAGAGGGATAGTGG + Intergenic
976213724 4:82695753-82695775 CTGAGCAAAGGTAGGGAGAGAGG - Intronic
977327983 4:95601533-95601555 TTGAGTTTAAGGGGTGAGAGAGG + Intergenic
977810162 4:101347856-101347878 CCGAGATTAGGGCAGGAGAGTGG + Exonic
981865255 4:149409739-149409761 CTGCTTTTAGAGAGGGAGTGTGG - Intergenic
983462534 4:168046481-168046503 GTGGGGGTAGGGAGGGAGAGAGG - Intergenic
984304387 4:177968850-177968872 CTAAGGTTGGTGAGGGAGAGGGG + Intronic
985726022 5:1516023-1516045 CTGAGTGCAGGGAGGTACAGAGG + Intronic
986041042 5:3994239-3994261 CTGTGCTTCAGGAGGGAGAGTGG + Intergenic
987927839 5:24364940-24364962 CAGTGTTTAGGCAGGGACAGGGG - Intergenic
987994529 5:25258660-25258682 CTGGTGTTAGGGAGGGAGAAAGG + Intergenic
989077207 5:37576140-37576162 TGGATTTTAGGGAGGGAGGGAGG - Intronic
989434887 5:41399538-41399560 CTGAGTTTAATGTGGGAGTGTGG - Intronic
990347088 5:54881823-54881845 CTGAATGTGGGGAGAGAGAGAGG - Intergenic
990364297 5:55054078-55054100 CTGTGTTTACTAAGGGAGAGAGG + Intergenic
990669747 5:58114760-58114782 GTGAGTTTAGGCAATGAGAGGGG + Intergenic
990902400 5:60766859-60766881 CTGGGGTTAGAGAGGGAGAATGG - Intronic
992116170 5:73540486-73540508 GAGTGTTGAGGGAGGGAGAGAGG + Intergenic
993005889 5:82427934-82427956 CTCAGTTTAGGGAGGCAAAGAGG - Intergenic
994335720 5:98563477-98563499 CTGTGTTTGGGGATGGAGAAAGG - Intergenic
996324582 5:122258529-122258551 CTCTGCGTAGGGAGGGAGAGTGG + Intergenic
999247795 5:150164545-150164567 CTGAGTCTGGGGAGGAAGACAGG - Intergenic
999288283 5:150407097-150407119 CTGAGTTGAGGGATGGTGGGAGG + Intronic
999696827 5:154194593-154194615 GTGAGTTTAGGGCAGGAGAAAGG - Intronic
1000555261 5:162718072-162718094 AAGAGTTTAGGGAGGGAGGCTGG - Intergenic
1001100168 5:168807784-168807806 CTGAGTCTAGGAAGCCAGAGTGG + Intronic
1001818818 5:174693764-174693786 CTGGGTTGAGAGATGGAGAGAGG + Intergenic
1001948262 5:175797623-175797645 CTGAGTTTCCGTAGGGGGAGGGG + Intronic
1002194303 5:177493890-177493912 CTGAGCTGAGGCAGGGAGAGGGG + Intronic
1002637220 5:180614420-180614442 CTGAGAGCTGGGAGGGAGAGGGG - Intronic
1003687489 6:8318745-8318767 ATGTGTGTATGGAGGGAGAGGGG - Intergenic
1004287332 6:14333813-14333835 ATGAGTTTTGGGAGGGAGGGTGG - Intergenic
1004558126 6:16719877-16719899 CAGAGCTTCGGGAGGGAGTGTGG + Intronic
1004624136 6:17358822-17358844 ATGAGTTTTGGGAGGGCCAGGGG + Intergenic
1004963558 6:20821099-20821121 CAGAGTGTTTGGAGGGAGAGCGG + Intronic
1006021024 6:31117642-31117664 GAGAGTTTAGGGATGGAGAAAGG + Intronic
1006373784 6:33660515-33660537 CAGATTTAAGGGAGGGAGGGAGG - Intronic
1006622837 6:35378543-35378565 CTGAGTTTGGGAAGGGAATGTGG - Intronic
1006681178 6:35797875-35797897 CTGACTATAGTGAGGCAGAGAGG - Intergenic
1007183498 6:39947937-39947959 ATGGGTGTAGGGAGGGAGGGAGG + Intergenic
1008859263 6:56129085-56129107 CAGAGTTGAGGAAGGGATAGTGG + Intronic
1011309316 6:85964499-85964521 AGGAGTTTAGGGAGGGTCAGGGG + Intergenic
1011419470 6:87155996-87156018 CCGAGTTCAGGGAAGGAAAGGGG - Intronic
1012741836 6:103027124-103027146 ATGAATTTGGGGAGGAAGAGTGG - Intergenic
1012930671 6:105313092-105313114 CTGGTTTTAGGGAGGTAGACTGG - Intronic
1014168314 6:118250567-118250589 CTGGATTTAGGGAGCCAGAGAGG + Intronic
1014406031 6:121052347-121052369 CTGTGTTCATGGAGGGAGACAGG - Intergenic
1014501458 6:122195209-122195231 CAGAGTTTCCGGAGGGAGTGTGG + Intergenic
1014670852 6:124301953-124301975 CTGAGTTTTGGGAGGGGCTGGGG + Intronic
1014806352 6:125833815-125833837 CTGAGTTTTGGGGGAGTGAGAGG - Intronic
1015007663 6:128303071-128303093 GTGAGTTTAGGGAAGGAAGGCGG - Intronic
1015480416 6:133702281-133702303 CTGGGTTGGGGGAGGCAGAGAGG - Intergenic
1015600067 6:134903172-134903194 CTGATTTCAGGGAGGGGAAGTGG - Intergenic
1015916157 6:138219287-138219309 CTGAGATTAGTGAGGGATAGTGG + Intronic
1017353949 6:153480071-153480093 CTGACTTTAAGGAGGGAAACTGG - Intergenic
1017748471 6:157468150-157468172 CTGAGTGGAGGGCTGGAGAGGGG + Intronic
1017845785 6:158257194-158257216 TTGTTTTTTGGGAGGGAGAGGGG - Intronic
1018306339 6:162460552-162460574 TTTATTTTAGGGAGGGACAGCGG - Intronic
1018422474 6:163651375-163651397 CTGCGTTTAGGGGAGGAGAGTGG + Intergenic
1018570433 6:165204137-165204159 ATGTGTTGAGGGAGGGAGGGAGG - Intergenic
1018906799 6:168080273-168080295 CTGAGCGGAGGGAGGGAGGGAGG - Intronic
1018982033 6:168608385-168608407 CTGAGTCCAGGCAGGGAGACAGG + Intronic
1019200589 6:170311080-170311102 CCCAGAATAGGGAGGGAGAGTGG + Intronic
1019557207 7:1638527-1638549 CTGAGAGGAGGGAGGGAGGGAGG + Intergenic
1019723416 7:2587195-2587217 CTGAGATGGGGGAGGCAGAGGGG + Intronic
1019825259 7:3279313-3279335 CAGAGTTGGGGGAGAGAGAGGGG + Intergenic
1019907084 7:4072954-4072976 CAGAGTTTACTGAAGGAGAGTGG - Intronic
1019918933 7:4150636-4150658 CTGAATGTAGGGAGGGAGGCAGG + Intronic
1019935008 7:4249091-4249113 GTGAGTGTGGGGAGGGAGGGAGG + Intronic
1020626183 7:10582432-10582454 CTGAGTAGAGGGAGAGAGATGGG - Intergenic
1020899454 7:13987297-13987319 GTCATGTTAGGGAGGGAGAGAGG + Intronic
1020969766 7:14921158-14921180 CAGAGGTTTTGGAGGGAGAGGGG + Intronic
1022226369 7:28367901-28367923 CTTAGTCTAGGGAGGGAGCAGGG - Intronic
1022384989 7:29891501-29891523 CTGAGTTGAGAGAGAGAGAAAGG + Intronic
1024221047 7:47286990-47287012 CTGAATATTGGGAGGAAGAGTGG - Intronic
1024425432 7:49220090-49220112 CTGAGGCTAGGGAGGAAGAAGGG + Intergenic
1024485230 7:49910138-49910160 CAGAGTTCAGGGAGGGAGAAGGG + Intronic
1024656819 7:51458053-51458075 CGGAGTTTAGGGTGGGAGTCGGG - Intergenic
1026479341 7:70764831-70764853 CTGTGGTTGGGCAGGGAGAGGGG - Exonic
1027232233 7:76279551-76279573 CTCTGTGTAGGGAGGGAGACAGG + Intronic
1027424418 7:78047882-78047904 CTGGGTTTTAGGAGGCAGAGAGG - Intronic
1027831096 7:83178862-83178884 ATGGGTATAGGGAGGGGGAGTGG - Intergenic
1029131368 7:98333732-98333754 CTTAGTTTGGGGAGGGTGGGCGG - Intronic
1030237405 7:107279962-107279984 TTGAGAGTAGGGAGGGACAGTGG - Intronic
1030503305 7:110387063-110387085 ATGTGTTCAGGGAGTGAGAGAGG - Intergenic
1031034490 7:116773542-116773564 CTGAGTTTAGAGAGGCTGATTGG + Intronic
1034333475 7:150304611-150304633 CTCACTTGAGGGAGGGAGGGAGG - Intronic
1034450249 7:151133427-151133449 CCGAGTGCAGGGAGGGAGGGTGG - Intronic
1034516568 7:151585522-151585544 CTGAGAACAGGGAGGGAGAATGG - Intronic
1034664568 7:152805279-152805301 CTCACTTGAGGGAGGGAGGGAGG + Intronic
1034829344 7:154295664-154295686 CTGAGGGTAGGGAGGGGAAGGGG - Intronic
1034988693 7:155533952-155533974 CTGAGGTTTGGGAGGGGGAGGGG + Intergenic
1035090831 7:156308649-156308671 CTAACTTTAGGCAGGGAGACTGG + Intergenic
1035448247 7:158957591-158957613 CTGAGATTAGGGAGGAAGAGGGG - Intergenic
1035578301 8:723139-723161 CTATGGTGAGGGAGGGAGAGCGG - Intronic
1036478188 8:9113395-9113417 CTGAGGAGAGGGAGGGAGATTGG + Intronic
1036563617 8:9919260-9919282 CTGAGCTTCGGGAGGCAGACCGG + Intergenic
1037020595 8:13965769-13965791 CTTGGTTTTGGGAGGGAGGGAGG - Intergenic
1037075515 8:14712240-14712262 CGGAGCTGAAGGAGGGAGAGGGG - Intronic
1037106044 8:15110193-15110215 CTGTCTTTAGGGAGGGAGGTAGG + Intronic
1038552252 8:28480364-28480386 TTGAGTTTAGAGGGGCAGAGGGG + Intronic
1038916307 8:32027473-32027495 CCTAGATTAGGGAGGGAGGGAGG - Intronic
1039469187 8:37803015-37803037 CTGTGATTAGGGAGGGGGAGTGG + Intronic
1040853375 8:51924706-51924728 CTGTGTTTTGGGAGAGACAGAGG - Intergenic
1042529713 8:69802634-69802656 GGGAGTTGAGGGAGGGAGAGTGG - Intronic
1043598515 8:81912899-81912921 ATCAGTTATGGGAGGGAGAGGGG - Intergenic
1043987162 8:86707539-86707561 CTGAGGTTAGTGAGGCAGTGGGG + Intronic
1044182538 8:89213609-89213631 GAGAGATTAGGGAGTGAGAGAGG - Intergenic
1045571307 8:103371506-103371528 AGGAATTAAGGGAGGGAGAGAGG + Exonic
1045721203 8:105112776-105112798 ACGTGTTTAGGGAGGGAGAATGG + Intronic
1045754575 8:105527642-105527664 GGGATTTTAGGGAGGCAGAGCGG + Intronic
1047340038 8:123972196-123972218 TTTAGGTTAGGGAGAGAGAGTGG + Intronic
1047730337 8:127722790-127722812 GTGGGTTTAGGCAGGGCGAGGGG - Intergenic
1048346549 8:133580200-133580222 ATGACTTGAGGGAAGGAGAGGGG - Intergenic
1048471354 8:134707053-134707075 CTGAGTTTGGGGAGGGGCATGGG - Intronic
1048517423 8:135123643-135123665 CTGAGTCTAGGGAGGCAAAGTGG - Intergenic
1048717181 8:137283101-137283123 CTGAGGTGAGGGTGGAAGAGAGG - Intergenic
1048968811 8:139632676-139632698 CTATCTTTAGGGAGGGAGCGGGG - Intronic
1048972022 8:139650533-139650555 CTCAGGTAAGGGAGGGACAGGGG - Intronic
1049417243 8:142500653-142500675 CTGAGGTCAGAGAGGGAGGGTGG + Intronic
1049569860 8:143364334-143364356 GTGTGCTTAGGGAGGGAGGGAGG - Intergenic
1051506224 9:17830538-17830560 CTGAGATTTTGGAGGGAGAAAGG - Intergenic
1051565290 9:18490320-18490342 TTGATTGGAGGGAGGGAGAGGGG + Intronic
1053163676 9:35829865-35829887 TTGAGTCTAGGCTGGGAGAGGGG - Exonic
1053659528 9:40258005-40258027 CTGTGTTCAGGGAGTGAGTGGGG + Intronic
1054525070 9:66118212-66118234 CTGTGTTCAGGGAGTGAGTGGGG - Intronic
1055890434 9:81117965-81117987 CTGAGTTAAGGGAAGGACAATGG - Intergenic
1057469741 9:95346964-95346986 CTGATTTGAGAGAGGCAGAGCGG - Intergenic
1057519705 9:95751534-95751556 CTGAGCTGTGGGAGGGAGGGAGG + Intergenic
1057519849 9:95751976-95751998 CTGAGCTCCGGGAGGGAGGGAGG + Intergenic
1057702886 9:97376379-97376401 CTGAGTTCAGTGAGGGTGGGAGG + Intronic
1057778793 9:98033415-98033437 CAGAGGTTAGGGAGGGGGTGGGG + Intergenic
1058483048 9:105416391-105416413 CACAGTTGAGGGATGGAGAGGGG + Intronic
1060933360 9:127502757-127502779 CTGGGCCTGGGGAGGGAGAGCGG - Exonic
1061260073 9:129475337-129475359 CAGAGAATGGGGAGGGAGAGGGG + Intergenic
1061700509 9:132411465-132411487 CCGAGTTTAGGGAAGGCAAGAGG - Intronic
1061714419 9:132509911-132509933 AGGAGTTTGGGGAGGGAGAAAGG - Intronic
1061777911 9:132978090-132978112 CTGAACTTGGGGAGGGAGGGAGG + Intronic
1062014364 9:134283858-134283880 AGGAGTTTAGGGTGGGAGCGGGG - Intergenic
1062362357 9:136193880-136193902 CGGAATTTAGGGAGGGGGCGCGG - Intergenic
1062478680 9:136741738-136741760 CTGAGTTTAGGGGGAGGAAGTGG + Intronic
1062538219 9:137030198-137030220 CTGGGCTCAGGGAGGGAGGGCGG - Exonic
1062680837 9:137779106-137779128 GTGAGTTTTGGGAGGGACAGAGG + Intronic
1186347864 X:8712993-8713015 ATGTGTTCAGGGAGAGAGAGTGG - Intronic
1186583557 X:10847171-10847193 CTGAGTGTGGGGAGGCAGTGAGG - Intergenic
1186596943 X:10992228-10992250 CTGGGCTTAGGCAGGAAGAGAGG + Intergenic
1186733142 X:12432004-12432026 CTGAGTTAAGGCAGGCAGGGAGG - Intronic
1187070356 X:15881456-15881478 AAGAGTTTAGGTAGGGGGAGGGG - Intergenic
1187157876 X:16738031-16738053 CAGTGTTTAGGGAGGGGAAGAGG + Intronic
1187258397 X:17661897-17661919 CTGAGTTGAGGCAAGGTGAGTGG - Intronic
1187340862 X:18420375-18420397 CTGACCATAGGGAGGTAGAGGGG - Intergenic
1187462512 X:19500576-19500598 CTTGGTTTGGGGAGGGAGAGTGG - Intronic
1187755087 X:22515834-22515856 TTTAGTTAAGAGAGGGAGAGAGG + Intergenic
1188404199 X:29786612-29786634 GTGGATTGAGGGAGGGAGAGAGG + Intronic
1188571214 X:31587750-31587772 CTGAGAGTACGGGGGGAGAGAGG - Intronic
1188572814 X:31609767-31609789 ATGAGTTTAGGTAGGGGCAGAGG - Intronic
1188774344 X:34194906-34194928 CTGGGGTGAGGGAGGGAGGGAGG - Intergenic
1189075054 X:37905950-37905972 CTGGGGGTGGGGAGGGAGAGGGG + Intronic
1189285973 X:39852714-39852736 CTGAGCTTAGTGAGGCAGAGAGG + Intergenic
1189417652 X:40829279-40829301 CTGAGTTTGGGGTAGAAGAGTGG + Intergenic
1192127863 X:68518687-68518709 CTGAATTCTAGGAGGGAGAGAGG + Intronic
1192220844 X:69196439-69196461 GAGAGTTCAGGGAGGGAGGGGGG - Intergenic
1192806316 X:74512610-74512632 CTGAGTTGAAAGAGAGAGAGGGG - Intronic
1193396129 X:80985672-80985694 CTGAGGAGAGGGAGGGAGAAGGG + Intergenic
1195746235 X:108121505-108121527 CTGAGTGTAGGGTGGGGCAGGGG - Intronic
1196124025 X:112081250-112081272 GTGTGTCTAGGGAGGGAGGGAGG + Intronic
1196410279 X:115411285-115411307 TTGTGGTTAGGGAGGGAGGGAGG + Intergenic
1197715291 X:129702031-129702053 CTGAGCTAAGGGAGCCAGAGAGG + Intergenic
1198113471 X:133522990-133523012 CTGAGATTGGGGAGAGAGAGTGG - Intergenic
1198208784 X:134496548-134496570 CTGAGTTCAGGTAGGGAGAAGGG + Intronic
1199058019 X:143319985-143320007 ATGGGTTTAGGAAAGGAGAGAGG + Intergenic
1199560030 X:149152048-149152070 CTCAGTCTATGGAGGGAGGGAGG - Intergenic
1200657867 Y:5925563-5925585 CTGACTTTTGGCTGGGAGAGAGG - Intergenic
1201226902 Y:11827198-11827220 CTGAGTCAAGGGAGGGAGTTTGG + Intergenic
1201691760 Y:16774963-16774985 ATGGGTGTAGGGAGGGAGGGAGG - Intergenic