ID: 1081570817

View in Genome Browser
Species Human (GRCh38)
Location 11:44289763-44289785
Sequence CTTAGAGCCCAGACTGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 1, 2: 1, 3: 24, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081570817_1081570821 4 Left 1081570817 11:44289763-44289785 CCAGCTTCAGTCTGGGCTCTAAG 0: 1
1: 1
2: 1
3: 24
4: 204
Right 1081570821 11:44289790-44289812 CCTGTCAGCTTCTCTCCTCAAGG 0: 1
1: 0
2: 1
3: 39
4: 300
1081570817_1081570824 22 Left 1081570817 11:44289763-44289785 CCAGCTTCAGTCTGGGCTCTAAG 0: 1
1: 1
2: 1
3: 24
4: 204
Right 1081570824 11:44289808-44289830 CAAGGAGGCTAGAAGTTTCCCGG 0: 1
1: 0
2: 1
3: 23
4: 172
1081570817_1081570822 7 Left 1081570817 11:44289763-44289785 CCAGCTTCAGTCTGGGCTCTAAG 0: 1
1: 1
2: 1
3: 24
4: 204
Right 1081570822 11:44289793-44289815 GTCAGCTTCTCTCCTCAAGGAGG 0: 1
1: 0
2: 2
3: 17
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081570817 Original CRISPR CTTAGAGCCCAGACTGAAGC TGG (reversed) Intronic
902930112 1:19725176-19725198 CCTAGGGCCCAGAGTGAAGCAGG + Intronic
905899835 1:41574219-41574241 CTTAGAGGCCACACAGAGGCAGG - Intronic
907110279 1:51920778-51920800 CCTAGAGCCCAGACTAGAGCTGG - Intronic
908411924 1:63875057-63875079 CATAGAGAACAGCCTGAAGCCGG + Intronic
909023670 1:70460098-70460120 CTTGGAGCCATGGCTGAAGCTGG - Intergenic
912221624 1:107683950-107683972 CTCACAGACCAGACTGAAGAAGG + Intronic
913241442 1:116833548-116833570 CTTCCAGCCTAGACTGAAGAAGG + Intergenic
915001788 1:152600828-152600850 CTTAGAGCACAGTCAGAAGAGGG - Exonic
916094799 1:161339708-161339730 CTTGTTGCCCAGACTGGAGCTGG + Intronic
917796564 1:178537211-178537233 CTCACAGCCCAGCATGAAGCAGG - Intronic
919739119 1:200971985-200972007 CTTGGCTCCCAGACTGAAGCGGG + Intronic
920967821 1:210715856-210715878 CTCAGAGCCCTTACTGAGGCAGG - Intronic
921278151 1:213539493-213539515 TTGAGAGCCCAGTCTGGAGCAGG - Intergenic
921820707 1:219613126-219613148 CTTAGAGCGCAGCCTGTAGCCGG - Intergenic
923097128 1:230784508-230784530 CTTTGAGCAGAGACTGGAGCTGG - Intronic
1063380835 10:5584667-5584689 CTTAGAACACAGACGCAAGCGGG + Intergenic
1066040974 10:31547838-31547860 CTTTGAGCCAAGGCTGGAGCTGG - Intergenic
1066376449 10:34861602-34861624 CTTGGAGCCCTCTCTGAAGCTGG + Intergenic
1068369120 10:56091058-56091080 CTTTGAACCATGACTGAAGCTGG - Intergenic
1069335166 10:67340585-67340607 CTTAGAGGCCAAACTGCACCTGG - Intronic
1071954061 10:90737654-90737676 TTCAGAGCACATACTGAAGCAGG + Intergenic
1075246509 10:120827199-120827221 TTTAGAGCCTAGACTGAAGGTGG + Intergenic
1075258059 10:120940683-120940705 CTCAGGGCCCAGGCTGAGGCCGG - Intergenic
1076280127 10:129239689-129239711 CACAGAGCCCAGACTGACTCTGG + Intergenic
1077457567 11:2690058-2690080 CCTTCAGCCCAGACAGAAGCAGG - Intronic
1077921236 11:6643224-6643246 GTGAGAGCACAGACTGAAGATGG + Intronic
1081447389 11:43144063-43144085 CTTACAGACCATACAGAAGCAGG - Intergenic
1081570817 11:44289763-44289785 CTTAGAGCCCAGACTGAAGCTGG - Intronic
1084308835 11:68304237-68304259 CTTTGAGCCAAGGCTGGAGCTGG - Intergenic
1085106553 11:73848700-73848722 TAAAGAGCCCAGACTGGAGCAGG - Intronic
1085253771 11:75160467-75160489 CATGGAGCCCAGACTACAGCAGG + Intronic
1085464902 11:76716694-76716716 GTCAGAGGCCAGACTGAGGCTGG - Intergenic
1086157675 11:83685701-83685723 CTTAGAGCACAGATTGAGACTGG - Intronic
1089328365 11:117672994-117673016 CTTAGAGCCCAGATCCAGGCAGG - Intronic
1089883422 11:121796477-121796499 ATAAGAGCACAGACAGAAGCAGG + Intergenic
1090544426 11:127747340-127747362 CTTTGAGCCCATACTGGAGCTGG + Intergenic
1090846795 11:130536340-130536362 CTTAGAGACCTGAATGAAACAGG + Intergenic
1091805754 12:3354798-3354820 TTTAGGACCCAGACTGGAGCTGG + Intergenic
1093988902 12:25568690-25568712 CTTTGAGCCATGGCTGAAGCTGG - Intronic
1094412986 12:30187742-30187764 CTTAGAGCCCAAACTGAAAATGG - Intergenic
1095532955 12:43211602-43211624 GTTAGAGCCCAGAATGGAGATGG - Intergenic
1095728041 12:45473958-45473980 CTTTGAGCCAAGGCTGGAGCTGG - Intergenic
1098939566 12:76518774-76518796 CTTTGAGCCGAGGCTGGAGCTGG + Intronic
1099658667 12:85527573-85527595 CTTTGAGCTCTGACTGGAGCTGG - Intergenic
1099898740 12:88681472-88681494 CTTTGAGCCATGGCTGAAGCTGG - Intergenic
1099990393 12:89714778-89714800 CTTTGAGCCAAGGCTGGAGCTGG + Intergenic
1100748189 12:97668295-97668317 CTTGGAGCCCAGACTGCTTCTGG + Intergenic
1101050143 12:100854020-100854042 CTTAGAAGCCAGACAGAATCCGG - Intronic
1101904838 12:108816831-108816853 CTGAGAGCACAGCCTGGAGCTGG + Intronic
1102053406 12:109879513-109879535 CGTAGAGCCCAAACTGAGGGAGG + Intronic
1102886980 12:116529725-116529747 CACAGTGCCCAGCCTGAAGCAGG + Intergenic
1104492174 12:129203726-129203748 CTTAGAGCTCAGGCAGAAACAGG - Intronic
1105528922 13:21200681-21200703 CTCTGAGCTGAGACTGAAGCTGG + Intergenic
1105890172 13:24677040-24677062 CATAGAGGCCAGGCTGCAGCCGG - Intergenic
1107693092 13:42971781-42971803 ATTAAAGCCCAGTTTGAAGCTGG - Intronic
1107916006 13:45151741-45151763 CTAGGAGCACTGACTGAAGCTGG - Exonic
1108282583 13:48874588-48874610 TTTAGAAGCCAGACTGGAGCTGG - Intergenic
1108524169 13:51271837-51271859 ATTACTGCCCAGACTGCAGCTGG - Intronic
1110065272 13:71096706-71096728 CCTAAAGCACAGATTGAAGCAGG - Intergenic
1110709689 13:78636610-78636632 CCTAGAGCCCAGAGGGAACCTGG - Intronic
1112563875 13:100535913-100535935 CAGAGAGCCCAGACTAGAGCTGG - Intronic
1113424210 13:110194533-110194555 CCGAGAGCCCAGAGTGAAGCTGG + Intronic
1113797333 13:113066117-113066139 CTCAGAGCCCAGTGTGAACCAGG + Exonic
1114170847 14:20271244-20271266 CTTTGAGCCAAGGCTGGAGCTGG + Intronic
1117881337 14:60316243-60316265 CTTAGAGCCCTGATGGAGGCAGG + Intergenic
1119399074 14:74349561-74349583 GCTAGAGCCCAGAATGAGGCTGG + Intronic
1121707688 14:96011231-96011253 CTTTGAGCCAAGGCTGGAGCTGG + Intergenic
1122842600 14:104473674-104473696 CTTGAAGCCCAGCCTGAAGGTGG + Intergenic
1125765222 15:42131043-42131065 CTTATTTCCCAGACTGAACCTGG - Intergenic
1129329308 15:74818831-74818853 CTCAGAGCCCTGTCAGAAGCAGG - Intronic
1129466514 15:75727248-75727270 CCTGGAGGCCAGACTGTAGCAGG - Exonic
1129833408 15:78685454-78685476 CTCAGAGCCCAGATGGCAGCTGG - Intronic
1131251409 15:90832879-90832901 GTTTGAGACCAGACTGAACCTGG + Intergenic
1131921604 15:97334207-97334229 TTTAATGCCCAGACAGAAGCAGG + Intergenic
1132657161 16:1046137-1046159 CTCAGAGCCCAGTCACAAGCTGG - Intergenic
1132758233 16:1496288-1496310 CTCAGAGCCCAGGAGGAAGCCGG + Intronic
1137000044 16:35221741-35221763 CTAAGAGCCCAGTTTGACGCAGG + Intergenic
1137019828 16:35414437-35414459 CTCAGAGCCCAGTTTGACGCAGG + Intergenic
1137033073 16:35543445-35543467 CTCAGAGCCCAGTTTGACGCAGG + Intergenic
1139435150 16:66932617-66932639 GTTATAGCCTAGACCGAAGCTGG - Intronic
1140132011 16:72171037-72171059 TTAAGAGCCCAGACTCGAGCTGG - Intronic
1142435567 16:90054814-90054836 CTTTGAGCCATGGCTGAAGCTGG - Intergenic
1143870668 17:9955613-9955635 CTAAGAGCCTAGACTGAAGCCGG - Intronic
1144494121 17:15736272-15736294 ATGGGAGCCCAGCCTGAAGCCGG + Intronic
1144906139 17:18640404-18640426 ATGGGAGCCCAGCCTGAAGCCGG - Intronic
1145278292 17:21449504-21449526 TTTAGAGGGAAGACTGAAGCAGG + Intergenic
1145316113 17:21735399-21735421 TTTAGAGGGAAGACTGAAGCAGG + Intergenic
1145401161 17:22534526-22534548 TTTAGAGGGAAGACTGAAGCAGG - Intergenic
1145714542 17:27007324-27007346 TTTAGAGGGAAGACTGAAGCAGG + Intergenic
1147882080 17:43660609-43660631 CTGAGAGCTAAGACTGAAGCTGG - Intronic
1147920417 17:43913401-43913423 ATTGGAGCCCAGACAGAAGAGGG + Intergenic
1148113926 17:45163557-45163579 CTAAGAACCAAGTCTGAAGCAGG + Intronic
1148129747 17:45255662-45255684 CTCAGAGCACAGCCTGCAGCGGG - Exonic
1148199996 17:45743895-45743917 CCTGGAGCCCAGACTGAGGGTGG + Intergenic
1148333396 17:46825384-46825406 CTCAGAGCCCAGGCGGAAGGTGG - Intronic
1156265138 18:35481097-35481119 CAGAGAACCCAGACTGGAGCTGG + Intronic
1157268906 18:46254487-46254509 CTCACAGCCCAGACTAAAACAGG - Intronic
1159896843 18:74005396-74005418 CTCAAAGGCCAGACTGAAGCTGG - Intergenic
1161055162 19:2187298-2187320 CTCAGAGCCAAGGCAGAAGCTGG - Intronic
1162938885 19:13996309-13996331 CTGAGAGCCCTGCCTGCAGCTGG + Intronic
1163023806 19:14497707-14497729 CTTAGATGCCAGGCTCAAGCAGG - Intergenic
1163310503 19:16511508-16511530 GCAAGAGCCGAGACTGAAGCTGG - Intronic
1165147559 19:33741124-33741146 CTTAGACCCCAGCCAGAATCTGG + Intronic
1167037594 19:47003271-47003293 CTTAGAGCCCCAACAAAAGCGGG - Exonic
925204853 2:1997006-1997028 TGTACAGCCCACACTGAAGCAGG - Intronic
928255983 2:29723048-29723070 CATAGAGAACAGACTGAAGGGGG - Intronic
930931223 2:56886050-56886072 CTTTGAGCCGAGGCTGGAGCTGG - Intergenic
931725412 2:65105473-65105495 CTTATTGCCCAGGCTGGAGCTGG - Intronic
932575241 2:72959108-72959130 CTTGGGGCCCTGCCTGAAGCAGG + Intronic
932665849 2:73698372-73698394 CTTTGAGCCAAGGCTGGAGCTGG - Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
933433565 2:82215392-82215414 CTTAAGGCCCAGACCCAAGCGGG + Intergenic
937726713 2:125175682-125175704 CTTTGAGCCGAGGCTGGAGCTGG - Intergenic
938613966 2:132978653-132978675 CTTAGAAACCAGACAGAAGCTGG + Intronic
947758187 2:232584318-232584340 CTTTGAGCCCATCATGAAGCTGG + Intergenic
947805645 2:232966177-232966199 CTGAGAGCCCAAACAGCAGCTGG - Intronic
948549460 2:238760139-238760161 CTCTGAGCCCAGAGTGATGCTGG + Intergenic
1168930983 20:1623673-1623695 CTTCGAGCCAAGACCGGAGCTGG + Intergenic
1171109848 20:22470936-22470958 CCCAGACCCCAGACTTAAGCTGG - Intergenic
1171500937 20:25592833-25592855 CTTAGAGGCCAGAGAGAAGTGGG + Intergenic
1172102182 20:32491622-32491644 GATAGAGCTCAGAATGAAGCGGG + Intronic
1172511620 20:35504798-35504820 TTTAGAGCCCAGGCTGCAGCGGG + Exonic
1172828073 20:37807271-37807293 CATAGACCCCAGAATAAAGCAGG + Intronic
1173088514 20:39948121-39948143 CCTAGTCCACAGACTGAAGCTGG + Intergenic
1176514464 21:7773863-7773885 CTTGGAGCCCATACTCAGGCTGG + Intergenic
1177051445 21:16239881-16239903 CTTGGAGCCCAGACTCAGGGAGG + Intergenic
1178029288 21:28505878-28505900 CTTTGAGCCAAGGCTGGAGCTGG + Intergenic
1178648577 21:34404387-34404409 CTTGGAGCCCATACTCAGGCTGG + Intronic
1179013553 21:37575019-37575041 CTAGGAGCGCAGACTGGAGCTGG + Intergenic
1180825423 22:18857878-18857900 CTGAGGGCCCAGAATGAACCTGG - Intronic
1181187308 22:21116669-21116691 CTGAGGGCCCAGAATGAACCTGG + Intergenic
1181211890 22:21293824-21293846 CTGAGGGCCCAGAATGAACCTGG - Intergenic
1181594649 22:23906474-23906496 CTTAGGGCCCAGACAGAGGCAGG - Intergenic
1184605782 22:45574080-45574102 CTCAGAGCCCACAGTGAGGCTGG - Intronic
1185235918 22:49712837-49712859 CCCAGAGCCCAGCCTGGAGCTGG - Intergenic
1203215063 22_KI270731v1_random:1608-1630 CTGAGGGCCCAGAATGAACCTGG + Intergenic
1203275570 22_KI270734v1_random:83781-83803 CTGAGGGCCCAGAATGAACCTGG - Intergenic
952664262 3:35885588-35885610 TTTAGAATCCAGAATGAAGCTGG - Intergenic
952809014 3:37384969-37384991 CTTAGAGCCAAGGTTAAAGCAGG - Intergenic
953885344 3:46711869-46711891 CATACCGCCCAGGCTGAAGCTGG - Intergenic
953972711 3:47359568-47359590 CTTTGAGCCCTGGCTGGAGCTGG - Intergenic
954457533 3:50607955-50607977 GTTGGAGTCCAGACGGAAGCTGG + Exonic
954673950 3:52305436-52305458 CTTAGAGTCCAGACAGACACAGG + Intergenic
954709550 3:52498567-52498589 GTTAGGGCCCAGAAGGAAGCGGG - Intronic
954752747 3:52822944-52822966 GTTAGATCCCAGCCTGTAGCTGG + Intronic
955195413 3:56801368-56801390 CTGAGAGTCCAGACAGAAGATGG + Intronic
956495143 3:69817300-69817322 CTTATAGCACAGACTGACTCTGG - Intronic
957293412 3:78306497-78306519 CTTTGAGCCATGGCTGAAGCTGG - Intergenic
958841443 3:99209841-99209863 CTTTGAGCCAAGGCTGGAGCTGG + Intergenic
960014861 3:112875711-112875733 CTTAGAGCCCAGAAGGTAGTGGG - Intergenic
960492341 3:118332983-118333005 CTTTCAGCCAAAACTGAAGCTGG - Intergenic
961316281 3:126037969-126037991 CTTTGAGCCATGGCTGAAGCTGG - Intronic
963521152 3:146361243-146361265 CTTTGAGCCAAGGCTGGAGCAGG - Intergenic
963900579 3:150728966-150728988 CTTAGAGCCCAGACAGATAGAGG - Intergenic
965370951 3:167862060-167862082 CACAGAGATCAGACTGAAGCTGG + Intergenic
966249003 3:177840877-177840899 CTGAGAGCTCAGTCTGCAGCTGG + Intergenic
967660793 3:192107018-192107040 CTTAGAAGACAGACTGAAGTTGG + Intergenic
972363882 4:38355328-38355350 TTTAGAGCCCACCCTGATGCAGG - Intergenic
972582263 4:40405366-40405388 CCTATAGCCCAGGCTGGAGCTGG + Intergenic
973729881 4:53813103-53813125 GTGAAAGTCCAGACTGAAGCAGG + Intronic
980830657 4:138126777-138126799 CTTTGAGCCAAGGCTGGAGCTGG - Intergenic
980839006 4:138234096-138234118 CTTAGAGCTCAGAGTCAAGTGGG - Intronic
982107606 4:152024390-152024412 CATAGAGTCCAGACTTAAGGAGG - Intergenic
982324813 4:154119452-154119474 CTTACAGCTCAGGCTGAGGCAGG - Intergenic
983985956 4:174060858-174060880 CTTAGAGCCCCAGCTGGAGCTGG + Intergenic
984844265 4:184096773-184096795 TTTAGAGTCCAGCCAGAAGCTGG - Intronic
985291876 4:188394885-188394907 CTGAGAGGCCAGAGTGAGGCCGG + Intergenic
985516199 5:346007-346029 CTCAGTGCCCAGGCTGACGCTGG + Intronic
987689217 5:21245307-21245329 CTTTGAGCCAAGGCTGGAGCTGG - Intergenic
988256212 5:28823229-28823251 CTTTTAGCCAAGGCTGAAGCTGG - Intergenic
990444093 5:55877666-55877688 CTTAGAGCCCAGAAGGCAGTGGG - Intronic
990520341 5:56573378-56573400 CTTTGAGCCAAGGCTCAAGCTGG + Intronic
992332971 5:75736651-75736673 CTTAAAACCCTGACTGAAACAGG + Intergenic
995559467 5:113364848-113364870 CTTTGAGCCAAGTCTGGAGCTGG + Intronic
996303557 5:122018614-122018636 CTTAGAGCTCAGGTTGGAGCTGG + Intronic
996356471 5:122601023-122601045 CTTTAAGCCATGACTGAAGCTGG + Intergenic
997664251 5:135615927-135615949 CTTTGAGCCATGGCTGAAGCTGG - Intergenic
998745835 5:145258987-145259009 CTTTGAGCCTGGACTGGAGCTGG - Intergenic
998904681 5:146892150-146892172 CTCTGAGCTCAGACTCAAGCTGG - Intronic
1003122635 6:3330307-3330329 CTTAGGGCCAAGCCTGAACCAGG - Intronic
1004565177 6:16789404-16789426 CTTTGAGCCAAGGCTGAAGCTGG + Intergenic
1005102595 6:22188869-22188891 CATAGAGGCAAGACTGAAACTGG - Intergenic
1006636445 6:35464647-35464669 CTTAGAGCCACGCCTGAGGCTGG - Intronic
1006988742 6:38194794-38194816 CCCAGAGCCCAGACTGACGTAGG - Intronic
1007361521 6:41360151-41360173 CTTTGAGCCAAGGCTGGAGCTGG - Intergenic
1008199136 6:48564693-48564715 CTTTGAGCCAAGGCTGGAGCTGG - Intergenic
1009564932 6:65301433-65301455 CTTAGAGCGCAGCCTGTAGCCGG + Intronic
1009877909 6:69529388-69529410 CTGTGAGCCAACACTGAAGCAGG - Intergenic
1011526602 6:88272102-88272124 CTTATTGCCCAGGCTGAAGCTGG + Intergenic
1012259198 6:97067857-97067879 CTTAGGGCCCAGAACAAAGCAGG - Intronic
1012663971 6:101943105-101943127 CTTAGAGCCATGGCTGGAGCTGG - Intronic
1016316620 6:142796176-142796198 CTCAGAGCCCTCAGTGAAGCAGG - Intronic
1020423689 7:8039698-8039720 CTAAAAGCCCAGACTTCAGCCGG + Intronic
1023594014 7:41810048-41810070 GTTAGAGCCCAGACTGAAGCCGG + Intergenic
1024755000 7:52518935-52518957 CTTTGAGCCATGACTGGAGCTGG + Intergenic
1025846180 7:65200295-65200317 CCTAGAGCCCAGAAGGAAGCTGG + Intergenic
1031669827 7:124528985-124529007 CTTTGAGCCCTGGCTGAAGATGG + Intergenic
1032431029 7:131861679-131861701 CTTAGAATCCAGCCTGTAGCTGG - Intergenic
1034338679 7:150339040-150339062 CTCAGAGCCCAGTTTGATGCAGG + Exonic
1036432860 8:8705952-8705974 CGTGGATCCCAGACTGATGCAGG - Intergenic
1040102902 8:43520995-43521017 CTTTGAGCCAGGGCTGAAGCTGG - Intergenic
1042287673 8:67132138-67132160 CTTAGAGCTCAGAGTGTGGCCGG + Intronic
1043101978 8:76058888-76058910 TTTTGAGCCCTGGCTGAAGCTGG - Intergenic
1045413233 8:101941086-101941108 CTTATAGCCTAGACTGCAGAGGG - Intronic
1045784314 8:105902843-105902865 CTTTTAGCCAAGGCTGAAGCTGG + Intergenic
1046757837 8:117989897-117989919 CTTAGAACCCAGACTGGAGGCGG + Intronic
1047938809 8:129807749-129807771 CTTTGAGCCAAGGCTGGAGCTGG - Intergenic
1048096473 8:131300675-131300697 CTTTGAGCTCCAACTGAAGCTGG + Intergenic
1049162030 8:141103786-141103808 CTGAGGGCCCAGACAGGAGCAGG - Intergenic
1056868893 9:90257906-90257928 ATTTGAACCCAGACTGGAGCTGG + Intergenic
1058847185 9:108972499-108972521 TTTAGAGGCCAGACTGTTGCAGG + Intronic
1060334246 9:122706373-122706395 CTTTGAGCCATGACTGGAGCTGG + Intergenic
1060348813 9:122839441-122839463 CTTTGAGCCAAGACTGGAGCTGG + Intergenic
1061038472 9:128126389-128126411 CTTAGACTCCAGGCTGAAACAGG - Intronic
1061386721 9:130294950-130294972 CTTTGACCCCAGCCTGAAGGAGG + Intronic
1061491485 9:130947328-130947350 CCAAGAGCCCAGACTGAATTAGG - Intergenic
1061860895 9:133468335-133468357 TGCAGAGCCCAGACTGAGGCTGG + Exonic
1186196905 X:7117899-7117921 CTTTGAGCCCTGGCTGAAGCAGG - Intronic
1186231793 X:7463223-7463245 CCCAGAGATCAGACTGAAGCTGG - Intergenic
1188166600 X:26871169-26871191 CTTTGAGCCAAGGCTGGAGCGGG + Intergenic
1189025378 X:37388570-37388592 CTTTGGGCCACGACTGAAGCTGG + Intronic
1189358254 X:40327829-40327851 CACAGAGCCAAGACTGAAACAGG + Intergenic
1190757631 X:53414605-53414627 CTCAGGGGCCAGACTGAAGTTGG + Intronic
1194093259 X:89603651-89603673 CTTTGAGCCAAGGCTGAAGCTGG - Intergenic
1195035079 X:100965107-100965129 CTTTGAGCCAAGGCTGGAGCTGG - Intergenic
1197040402 X:121929769-121929791 CTTTTAGCCAAGACTGAAGCTGG - Intergenic
1197569494 X:128131627-128131649 CTTTTAGCCGTGACTGAAGCTGG - Intergenic
1199655230 X:149988036-149988058 CAGAGAGCCAAGGCTGAAGCGGG - Intergenic
1200278090 X:154752732-154752754 ATTTGAGACCAGACTCAAGCAGG - Intergenic
1200445891 Y:3259754-3259776 CTTTGAGCCAAGGCTGAAGCTGG - Intergenic
1201569532 Y:15399341-15399363 CTTTGAGCCCTGGCTGAAGCTGG - Intergenic