ID: 1081579060

View in Genome Browser
Species Human (GRCh38)
Location 11:44339531-44339553
Sequence CTGGAGAGACAGATCTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081579049_1081579060 30 Left 1081579049 11:44339478-44339500 CCTGGTGCCTGAGACAGGAGGGC No data
Right 1081579060 11:44339531-44339553 CTGGAGAGACAGATCTGGCCTGG No data
1081579055_1081579060 1 Left 1081579055 11:44339507-44339529 CCTGACTCCTCTCTCACAGTTAG No data
Right 1081579060 11:44339531-44339553 CTGGAGAGACAGATCTGGCCTGG No data
1081579054_1081579060 7 Left 1081579054 11:44339501-44339523 CCTGGGCCTGACTCCTCTCTCAC No data
Right 1081579060 11:44339531-44339553 CTGGAGAGACAGATCTGGCCTGG No data
1081579058_1081579060 -6 Left 1081579058 11:44339514-44339536 CCTCTCTCACAGTTAGGCTGGAG No data
Right 1081579060 11:44339531-44339553 CTGGAGAGACAGATCTGGCCTGG No data
1081579053_1081579060 8 Left 1081579053 11:44339500-44339522 CCCTGGGCCTGACTCCTCTCTCA No data
Right 1081579060 11:44339531-44339553 CTGGAGAGACAGATCTGGCCTGG No data
1081579052_1081579060 23 Left 1081579052 11:44339485-44339507 CCTGAGACAGGAGGGCCCTGGGC No data
Right 1081579060 11:44339531-44339553 CTGGAGAGACAGATCTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081579060 Original CRISPR CTGGAGAGACAGATCTGGCC TGG Intergenic
No off target data available for this crispr