ID: 1081581368

View in Genome Browser
Species Human (GRCh38)
Location 11:44354580-44354602
Sequence TGAGAGGTAAAAATTTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081581368_1081581372 4 Left 1081581368 11:44354580-44354602 CCTGGCCAAATTTTTACCTCTCA No data
Right 1081581372 11:44354607-44354629 CTCACTTCCTCCTCTATGTTCGG No data
1081581368_1081581376 15 Left 1081581368 11:44354580-44354602 CCTGGCCAAATTTTTACCTCTCA No data
Right 1081581376 11:44354618-44354640 CTCTATGTTCGGGAGAAGAGAGG No data
1081581368_1081581373 5 Left 1081581368 11:44354580-44354602 CCTGGCCAAATTTTTACCTCTCA No data
Right 1081581373 11:44354608-44354630 TCACTTCCTCCTCTATGTTCGGG No data
1081581368_1081581377 30 Left 1081581368 11:44354580-44354602 CCTGGCCAAATTTTTACCTCTCA No data
Right 1081581377 11:44354633-44354655 AAGAGAGGATTCAATGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081581368 Original CRISPR TGAGAGGTAAAAATTTGGCC AGG (reversed) Intergenic
No off target data available for this crispr