ID: 1081581369

View in Genome Browser
Species Human (GRCh38)
Location 11:44354585-44354607
Sequence GGCACTGAGAGGTAAAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081581369_1081581373 0 Left 1081581369 11:44354585-44354607 CCAAATTTTTACCTCTCAGTGCC No data
Right 1081581373 11:44354608-44354630 TCACTTCCTCCTCTATGTTCGGG No data
1081581369_1081581376 10 Left 1081581369 11:44354585-44354607 CCAAATTTTTACCTCTCAGTGCC No data
Right 1081581376 11:44354618-44354640 CTCTATGTTCGGGAGAAGAGAGG No data
1081581369_1081581377 25 Left 1081581369 11:44354585-44354607 CCAAATTTTTACCTCTCAGTGCC No data
Right 1081581377 11:44354633-44354655 AAGAGAGGATTCAATGAGCCAGG No data
1081581369_1081581372 -1 Left 1081581369 11:44354585-44354607 CCAAATTTTTACCTCTCAGTGCC No data
Right 1081581372 11:44354607-44354629 CTCACTTCCTCCTCTATGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081581369 Original CRISPR GGCACTGAGAGGTAAAAATT TGG (reversed) Intergenic
No off target data available for this crispr