ID: 1081581373

View in Genome Browser
Species Human (GRCh38)
Location 11:44354608-44354630
Sequence TCACTTCCTCCTCTATGTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081581368_1081581373 5 Left 1081581368 11:44354580-44354602 CCTGGCCAAATTTTTACCTCTCA No data
Right 1081581373 11:44354608-44354630 TCACTTCCTCCTCTATGTTCGGG No data
1081581366_1081581373 18 Left 1081581366 11:44354567-44354589 CCAACTGTGGGTCCCTGGCCAAA No data
Right 1081581373 11:44354608-44354630 TCACTTCCTCCTCTATGTTCGGG No data
1081581369_1081581373 0 Left 1081581369 11:44354585-44354607 CCAAATTTTTACCTCTCAGTGCC No data
Right 1081581373 11:44354608-44354630 TCACTTCCTCCTCTATGTTCGGG No data
1081581363_1081581373 30 Left 1081581363 11:44354555-44354577 CCTCTCTGTTGACCAACTGTGGG No data
Right 1081581373 11:44354608-44354630 TCACTTCCTCCTCTATGTTCGGG No data
1081581367_1081581373 6 Left 1081581367 11:44354579-44354601 CCCTGGCCAAATTTTTACCTCTC No data
Right 1081581373 11:44354608-44354630 TCACTTCCTCCTCTATGTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081581373 Original CRISPR TCACTTCCTCCTCTATGTTC GGG Intergenic
No off target data available for this crispr