ID: 1081582254

View in Genome Browser
Species Human (GRCh38)
Location 11:44360394-44360416
Sequence CAGGGGTCCCAGCATGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081582254_1081582264 29 Left 1081582254 11:44360394-44360416 CCCTGATCATGCTGGGACCCCTG No data
Right 1081582264 11:44360446-44360468 ATTGACTTTCATCCCTCCAAAGG No data
1081582254_1081582258 -5 Left 1081582254 11:44360394-44360416 CCCTGATCATGCTGGGACCCCTG No data
Right 1081582258 11:44360412-44360434 CCCTGTTTCCTCTTCCAAGCCGG No data
1081582254_1081582265 30 Left 1081582254 11:44360394-44360416 CCCTGATCATGCTGGGACCCCTG No data
Right 1081582265 11:44360447-44360469 TTGACTTTCATCCCTCCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081582254 Original CRISPR CAGGGGTCCCAGCATGATCA GGG (reversed) Intergenic
No off target data available for this crispr