ID: 1081583319

View in Genome Browser
Species Human (GRCh38)
Location 11:44367070-44367092
Sequence TGGAAGAGGCTGACCCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081583310_1081583319 20 Left 1081583310 11:44367027-44367049 CCACCTAGGTAAGACACTGGCCC No data
Right 1081583319 11:44367070-44367092 TGGAAGAGGCTGACCCTGCCTGG No data
1081583309_1081583319 21 Left 1081583309 11:44367026-44367048 CCCACCTAGGTAAGACACTGGCC No data
Right 1081583319 11:44367070-44367092 TGGAAGAGGCTGACCCTGCCTGG No data
1081583315_1081583319 -1 Left 1081583315 11:44367048-44367070 CCAGTGCAAACTGCTTCCAGGGT No data
Right 1081583319 11:44367070-44367092 TGGAAGAGGCTGACCCTGCCTGG No data
1081583311_1081583319 17 Left 1081583311 11:44367030-44367052 CCTAGGTAAGACACTGGCCCAGT No data
Right 1081583319 11:44367070-44367092 TGGAAGAGGCTGACCCTGCCTGG No data
1081583313_1081583319 0 Left 1081583313 11:44367047-44367069 CCCAGTGCAAACTGCTTCCAGGG No data
Right 1081583319 11:44367070-44367092 TGGAAGAGGCTGACCCTGCCTGG No data
1081583307_1081583319 24 Left 1081583307 11:44367023-44367045 CCTCCCACCTAGGTAAGACACTG No data
Right 1081583319 11:44367070-44367092 TGGAAGAGGCTGACCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081583319 Original CRISPR TGGAAGAGGCTGACCCTGCC TGG Intergenic
No off target data available for this crispr