ID: 1081584756

View in Genome Browser
Species Human (GRCh38)
Location 11:44376696-44376718
Sequence GACCCAGCTGATGGGGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081584756_1081584760 -9 Left 1081584756 11:44376696-44376718 CCTCTGGCCCCATCAGCTGGGTC No data
Right 1081584760 11:44376710-44376732 AGCTGGGTCCTGCTTGTTCCTGG No data
1081584756_1081584771 29 Left 1081584756 11:44376696-44376718 CCTCTGGCCCCATCAGCTGGGTC No data
Right 1081584771 11:44376748-44376770 CAGTGTGACCACACGGGGGATGG No data
1081584756_1081584762 2 Left 1081584756 11:44376696-44376718 CCTCTGGCCCCATCAGCTGGGTC No data
Right 1081584762 11:44376721-44376743 GCTTGTTCCTGGCCATGCTCTGG No data
1081584756_1081584765 22 Left 1081584756 11:44376696-44376718 CCTCTGGCCCCATCAGCTGGGTC No data
Right 1081584765 11:44376741-44376763 TGGCCACCAGTGTGACCACACGG No data
1081584756_1081584766 23 Left 1081584756 11:44376696-44376718 CCTCTGGCCCCATCAGCTGGGTC No data
Right 1081584766 11:44376742-44376764 GGCCACCAGTGTGACCACACGGG No data
1081584756_1081584767 24 Left 1081584756 11:44376696-44376718 CCTCTGGCCCCATCAGCTGGGTC No data
Right 1081584767 11:44376743-44376765 GCCACCAGTGTGACCACACGGGG No data
1081584756_1081584769 25 Left 1081584756 11:44376696-44376718 CCTCTGGCCCCATCAGCTGGGTC No data
Right 1081584769 11:44376744-44376766 CCACCAGTGTGACCACACGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081584756 Original CRISPR GACCCAGCTGATGGGGCCAG AGG (reversed) Intergenic
No off target data available for this crispr