ID: 1081584757

View in Genome Browser
Species Human (GRCh38)
Location 11:44376703-44376725
Sequence CAAGCAGGACCCAGCTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081584757_1081584771 22 Left 1081584757 11:44376703-44376725 CCCCATCAGCTGGGTCCTGCTTG No data
Right 1081584771 11:44376748-44376770 CAGTGTGACCACACGGGGGATGG No data
1081584757_1081584769 18 Left 1081584757 11:44376703-44376725 CCCCATCAGCTGGGTCCTGCTTG No data
Right 1081584769 11:44376744-44376766 CCACCAGTGTGACCACACGGGGG No data
1081584757_1081584762 -5 Left 1081584757 11:44376703-44376725 CCCCATCAGCTGGGTCCTGCTTG No data
Right 1081584762 11:44376721-44376743 GCTTGTTCCTGGCCATGCTCTGG No data
1081584757_1081584765 15 Left 1081584757 11:44376703-44376725 CCCCATCAGCTGGGTCCTGCTTG No data
Right 1081584765 11:44376741-44376763 TGGCCACCAGTGTGACCACACGG No data
1081584757_1081584767 17 Left 1081584757 11:44376703-44376725 CCCCATCAGCTGGGTCCTGCTTG No data
Right 1081584767 11:44376743-44376765 GCCACCAGTGTGACCACACGGGG No data
1081584757_1081584766 16 Left 1081584757 11:44376703-44376725 CCCCATCAGCTGGGTCCTGCTTG No data
Right 1081584766 11:44376742-44376764 GGCCACCAGTGTGACCACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081584757 Original CRISPR CAAGCAGGACCCAGCTGATG GGG (reversed) Intergenic
No off target data available for this crispr