ID: 1081584761

View in Genome Browser
Species Human (GRCh38)
Location 11:44376718-44376740
Sequence GAGCATGGCCAGGAACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081584761_1081584765 0 Left 1081584761 11:44376718-44376740 CCTGCTTGTTCCTGGCCATGCTC No data
Right 1081584765 11:44376741-44376763 TGGCCACCAGTGTGACCACACGG No data
1081584761_1081584767 2 Left 1081584761 11:44376718-44376740 CCTGCTTGTTCCTGGCCATGCTC No data
Right 1081584767 11:44376743-44376765 GCCACCAGTGTGACCACACGGGG No data
1081584761_1081584771 7 Left 1081584761 11:44376718-44376740 CCTGCTTGTTCCTGGCCATGCTC No data
Right 1081584771 11:44376748-44376770 CAGTGTGACCACACGGGGGATGG No data
1081584761_1081584773 19 Left 1081584761 11:44376718-44376740 CCTGCTTGTTCCTGGCCATGCTC No data
Right 1081584773 11:44376760-44376782 ACGGGGGATGGCCCAACCTCAGG No data
1081584761_1081584769 3 Left 1081584761 11:44376718-44376740 CCTGCTTGTTCCTGGCCATGCTC No data
Right 1081584769 11:44376744-44376766 CCACCAGTGTGACCACACGGGGG No data
1081584761_1081584775 30 Left 1081584761 11:44376718-44376740 CCTGCTTGTTCCTGGCCATGCTC No data
Right 1081584775 11:44376771-44376793 CCCAACCTCAGGAACAACCCAGG No data
1081584761_1081584766 1 Left 1081584761 11:44376718-44376740 CCTGCTTGTTCCTGGCCATGCTC No data
Right 1081584766 11:44376742-44376764 GGCCACCAGTGTGACCACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081584761 Original CRISPR GAGCATGGCCAGGAACAAGC AGG (reversed) Intergenic
No off target data available for this crispr