ID: 1081584767

View in Genome Browser
Species Human (GRCh38)
Location 11:44376743-44376765
Sequence GCCACCAGTGTGACCACACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081584763_1081584767 -8 Left 1081584763 11:44376728-44376750 CCTGGCCATGCTCTGGCCACCAG No data
Right 1081584767 11:44376743-44376765 GCCACCAGTGTGACCACACGGGG No data
1081584761_1081584767 2 Left 1081584761 11:44376718-44376740 CCTGCTTGTTCCTGGCCATGCTC No data
Right 1081584767 11:44376743-44376765 GCCACCAGTGTGACCACACGGGG No data
1081584756_1081584767 24 Left 1081584756 11:44376696-44376718 CCTCTGGCCCCATCAGCTGGGTC No data
Right 1081584767 11:44376743-44376765 GCCACCAGTGTGACCACACGGGG No data
1081584759_1081584767 15 Left 1081584759 11:44376705-44376727 CCATCAGCTGGGTCCTGCTTGTT No data
Right 1081584767 11:44376743-44376765 GCCACCAGTGTGACCACACGGGG No data
1081584757_1081584767 17 Left 1081584757 11:44376703-44376725 CCCCATCAGCTGGGTCCTGCTTG No data
Right 1081584767 11:44376743-44376765 GCCACCAGTGTGACCACACGGGG No data
1081584758_1081584767 16 Left 1081584758 11:44376704-44376726 CCCATCAGCTGGGTCCTGCTTGT No data
Right 1081584767 11:44376743-44376765 GCCACCAGTGTGACCACACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081584767 Original CRISPR GCCACCAGTGTGACCACACG GGG Intergenic
No off target data available for this crispr