ID: 1081584771

View in Genome Browser
Species Human (GRCh38)
Location 11:44376748-44376770
Sequence CAGTGTGACCACACGGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081584756_1081584771 29 Left 1081584756 11:44376696-44376718 CCTCTGGCCCCATCAGCTGGGTC No data
Right 1081584771 11:44376748-44376770 CAGTGTGACCACACGGGGGATGG No data
1081584758_1081584771 21 Left 1081584758 11:44376704-44376726 CCCATCAGCTGGGTCCTGCTTGT No data
Right 1081584771 11:44376748-44376770 CAGTGTGACCACACGGGGGATGG No data
1081584757_1081584771 22 Left 1081584757 11:44376703-44376725 CCCCATCAGCTGGGTCCTGCTTG No data
Right 1081584771 11:44376748-44376770 CAGTGTGACCACACGGGGGATGG No data
1081584761_1081584771 7 Left 1081584761 11:44376718-44376740 CCTGCTTGTTCCTGGCCATGCTC No data
Right 1081584771 11:44376748-44376770 CAGTGTGACCACACGGGGGATGG No data
1081584763_1081584771 -3 Left 1081584763 11:44376728-44376750 CCTGGCCATGCTCTGGCCACCAG No data
Right 1081584771 11:44376748-44376770 CAGTGTGACCACACGGGGGATGG No data
1081584759_1081584771 20 Left 1081584759 11:44376705-44376727 CCATCAGCTGGGTCCTGCTTGTT No data
Right 1081584771 11:44376748-44376770 CAGTGTGACCACACGGGGGATGG No data
1081584764_1081584771 -8 Left 1081584764 11:44376733-44376755 CCATGCTCTGGCCACCAGTGTGA No data
Right 1081584771 11:44376748-44376770 CAGTGTGACCACACGGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081584771 Original CRISPR CAGTGTGACCACACGGGGGA TGG Intergenic
No off target data available for this crispr