ID: 1081585099

View in Genome Browser
Species Human (GRCh38)
Location 11:44378813-44378835
Sequence GGGGATACCCTTTCAACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081585099_1081585104 1 Left 1081585099 11:44378813-44378835 CCAGTGGTTGAAAGGGTATCCCC No data
Right 1081585104 11:44378837-44378859 GTGGTCTTTACAAATGAGTTAGG No data
1081585099_1081585105 12 Left 1081585099 11:44378813-44378835 CCAGTGGTTGAAAGGGTATCCCC No data
Right 1081585105 11:44378848-44378870 AAATGAGTTAGGAAGTCCTCAGG No data
1081585099_1081585106 21 Left 1081585099 11:44378813-44378835 CCAGTGGTTGAAAGGGTATCCCC No data
Right 1081585106 11:44378857-44378879 AGGAAGTCCTCAGGCTATGTCGG No data
1081585099_1081585109 30 Left 1081585099 11:44378813-44378835 CCAGTGGTTGAAAGGGTATCCCC No data
Right 1081585109 11:44378866-44378888 TCAGGCTATGTCGGACTCATGGG No data
1081585099_1081585108 29 Left 1081585099 11:44378813-44378835 CCAGTGGTTGAAAGGGTATCCCC No data
Right 1081585108 11:44378865-44378887 CTCAGGCTATGTCGGACTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081585099 Original CRISPR GGGGATACCCTTTCAACCAC TGG (reversed) Intergenic
No off target data available for this crispr