ID: 1081585212

View in Genome Browser
Species Human (GRCh38)
Location 11:44379633-44379655
Sequence ACTCCCACACAGACTTAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081585210_1081585212 12 Left 1081585210 11:44379598-44379620 CCTGTATACACAGACGGGCAGCA No data
Right 1081585212 11:44379633-44379655 ACTCCCACACAGACTTAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081585212 Original CRISPR ACTCCCACACAGACTTAGGT TGG Intergenic
No off target data available for this crispr