ID: 1081586134

View in Genome Browser
Species Human (GRCh38)
Location 11:44385152-44385174
Sequence GCTTCTCCCCTCCATCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081586131_1081586134 5 Left 1081586131 11:44385124-44385146 CCTAAGATGAGCCCATGAAGTTA No data
Right 1081586134 11:44385152-44385174 GCTTCTCCCCTCCATCAGTGAGG No data
1081586132_1081586134 -6 Left 1081586132 11:44385135-44385157 CCCATGAAGTTAACAGTGCTTCT No data
Right 1081586134 11:44385152-44385174 GCTTCTCCCCTCCATCAGTGAGG No data
1081586133_1081586134 -7 Left 1081586133 11:44385136-44385158 CCATGAAGTTAACAGTGCTTCTC No data
Right 1081586134 11:44385152-44385174 GCTTCTCCCCTCCATCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081586134 Original CRISPR GCTTCTCCCCTCCATCAGTG AGG Intergenic
No off target data available for this crispr