ID: 1081591127

View in Genome Browser
Species Human (GRCh38)
Location 11:44423916-44423938
Sequence TGGTGAGTGAGGCGGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081591127_1081591140 14 Left 1081591127 11:44423916-44423938 CCCTCCCCCCGCCTCACTCACCA No data
Right 1081591140 11:44423953-44423975 CAGGCTTCCGGTTCATCACTCGG No data
1081591127_1081591137 2 Left 1081591127 11:44423916-44423938 CCCTCCCCCCGCCTCACTCACCA No data
Right 1081591137 11:44423941-44423963 CTTCTGCCACGCCAGGCTTCCGG No data
1081591127_1081591135 -5 Left 1081591127 11:44423916-44423938 CCCTCCCCCCGCCTCACTCACCA No data
Right 1081591135 11:44423934-44423956 CACCATGCTTCTGCCACGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081591127 Original CRISPR TGGTGAGTGAGGCGGGGGGA GGG (reversed) Intergenic
No off target data available for this crispr