ID: 1081591127 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:44423916-44423938 |
Sequence | TGGTGAGTGAGGCGGGGGGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1081591127_1081591140 | 14 | Left | 1081591127 | 11:44423916-44423938 | CCCTCCCCCCGCCTCACTCACCA | No data | ||
Right | 1081591140 | 11:44423953-44423975 | CAGGCTTCCGGTTCATCACTCGG | No data | ||||
1081591127_1081591137 | 2 | Left | 1081591127 | 11:44423916-44423938 | CCCTCCCCCCGCCTCACTCACCA | No data | ||
Right | 1081591137 | 11:44423941-44423963 | CTTCTGCCACGCCAGGCTTCCGG | No data | ||||
1081591127_1081591135 | -5 | Left | 1081591127 | 11:44423916-44423938 | CCCTCCCCCCGCCTCACTCACCA | No data | ||
Right | 1081591135 | 11:44423934-44423956 | CACCATGCTTCTGCCACGCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1081591127 | Original CRISPR | TGGTGAGTGAGGCGGGGGGA GGG (reversed) | Intergenic | ||
No off target data available for this crispr |