ID: 1081591271

View in Genome Browser
Species Human (GRCh38)
Location 11:44424904-44424926
Sequence ATCAAAAATGTCTCCAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081591271_1081591273 -6 Left 1081591271 11:44424904-44424926 CCATGGCTGGAGACATTTTTGAT No data
Right 1081591273 11:44424921-44424943 TTTGATTTTCATACCTGGTATGG No data
1081591271_1081591275 4 Left 1081591271 11:44424904-44424926 CCATGGCTGGAGACATTTTTGAT No data
Right 1081591275 11:44424931-44424953 ATACCTGGTATGGAAGAGAAGGG No data
1081591271_1081591279 29 Left 1081591271 11:44424904-44424926 CCATGGCTGGAGACATTTTTGAT No data
Right 1081591279 11:44424956-44424978 TGGTACTACTGGCATCTAGTAGG No data
1081591271_1081591278 18 Left 1081591271 11:44424904-44424926 CCATGGCTGGAGACATTTTTGAT No data
Right 1081591278 11:44424945-44424967 AGAGAAGGGAATGGTACTACTGG No data
1081591271_1081591274 3 Left 1081591271 11:44424904-44424926 CCATGGCTGGAGACATTTTTGAT No data
Right 1081591274 11:44424930-44424952 CATACCTGGTATGGAAGAGAAGG No data
1081591271_1081591277 9 Left 1081591271 11:44424904-44424926 CCATGGCTGGAGACATTTTTGAT No data
Right 1081591277 11:44424936-44424958 TGGTATGGAAGAGAAGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081591271 Original CRISPR ATCAAAAATGTCTCCAGCCA TGG (reversed) Intergenic
No off target data available for this crispr