ID: 1081591760

View in Genome Browser
Species Human (GRCh38)
Location 11:44427960-44427982
Sequence TGCCATCGCCATATTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081591760_1081591769 13 Left 1081591760 11:44427960-44427982 CCTTCCCCAATATGGCGATGGCA No data
Right 1081591769 11:44427996-44428018 TCTGTTTACAGTTGGGAGGGAGG No data
1081591760_1081591766 6 Left 1081591760 11:44427960-44427982 CCTTCCCCAATATGGCGATGGCA No data
Right 1081591766 11:44427989-44428011 AAAGGCTTCTGTTTACAGTTGGG No data
1081591760_1081591765 5 Left 1081591760 11:44427960-44427982 CCTTCCCCAATATGGCGATGGCA No data
Right 1081591765 11:44427988-44428010 GAAAGGCTTCTGTTTACAGTTGG No data
1081591760_1081591767 9 Left 1081591760 11:44427960-44427982 CCTTCCCCAATATGGCGATGGCA No data
Right 1081591767 11:44427992-44428014 GGCTTCTGTTTACAGTTGGGAGG No data
1081591760_1081591771 27 Left 1081591760 11:44427960-44427982 CCTTCCCCAATATGGCGATGGCA No data
Right 1081591771 11:44428010-44428032 GGAGGGAGGTCCAGAGGACGAGG No data
1081591760_1081591772 28 Left 1081591760 11:44427960-44427982 CCTTCCCCAATATGGCGATGGCA No data
Right 1081591772 11:44428011-44428033 GAGGGAGGTCCAGAGGACGAGGG No data
1081591760_1081591770 21 Left 1081591760 11:44427960-44427982 CCTTCCCCAATATGGCGATGGCA No data
Right 1081591770 11:44428004-44428026 CAGTTGGGAGGGAGGTCCAGAGG No data
1081591760_1081591768 10 Left 1081591760 11:44427960-44427982 CCTTCCCCAATATGGCGATGGCA No data
Right 1081591768 11:44427993-44428015 GCTTCTGTTTACAGTTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081591760 Original CRISPR TGCCATCGCCATATTGGGGA AGG (reversed) Intergenic
No off target data available for this crispr