ID: 1081592365

View in Genome Browser
Species Human (GRCh38)
Location 11:44433423-44433445
Sequence CTCATCAATGAAGCATATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081592362_1081592365 -9 Left 1081592362 11:44433409-44433431 CCATTCTCAGAGAGCTCATCAAT No data
Right 1081592365 11:44433423-44433445 CTCATCAATGAAGCATATTGGGG No data
1081592357_1081592365 28 Left 1081592357 11:44433372-44433394 CCCTATGTTTTCCAAGAATATTC No data
Right 1081592365 11:44433423-44433445 CTCATCAATGAAGCATATTGGGG No data
1081592359_1081592365 17 Left 1081592359 11:44433383-44433405 CCAAGAATATTCCTCTTTTCCAA No data
Right 1081592365 11:44433423-44433445 CTCATCAATGAAGCATATTGGGG No data
1081592358_1081592365 27 Left 1081592358 11:44433373-44433395 CCTATGTTTTCCAAGAATATTCC No data
Right 1081592365 11:44433423-44433445 CTCATCAATGAAGCATATTGGGG No data
1081592361_1081592365 -2 Left 1081592361 11:44433402-44433424 CCAAGCTCCATTCTCAGAGAGCT No data
Right 1081592365 11:44433423-44433445 CTCATCAATGAAGCATATTGGGG No data
1081592356_1081592365 29 Left 1081592356 11:44433371-44433393 CCCCTATGTTTTCCAAGAATATT No data
Right 1081592365 11:44433423-44433445 CTCATCAATGAAGCATATTGGGG No data
1081592360_1081592365 6 Left 1081592360 11:44433394-44433416 CCTCTTTTCCAAGCTCCATTCTC No data
Right 1081592365 11:44433423-44433445 CTCATCAATGAAGCATATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081592365 Original CRISPR CTCATCAATGAAGCATATTG GGG Intergenic
No off target data available for this crispr