ID: 1081594015

View in Genome Browser
Species Human (GRCh38)
Location 11:44446807-44446829
Sequence GCCCAGACCCAGAGAGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081594015_1081594021 8 Left 1081594015 11:44446807-44446829 CCCCTTCCTCTCTGGGTCTGGGC No data
Right 1081594021 11:44446838-44446860 TCTATCAGCCTGGCAGATTCTGG No data
1081594015_1081594023 17 Left 1081594015 11:44446807-44446829 CCCCTTCCTCTCTGGGTCTGGGC No data
Right 1081594023 11:44446847-44446869 CTGGCAGATTCTGGAACGCCTGG No data
1081594015_1081594019 -2 Left 1081594015 11:44446807-44446829 CCCCTTCCTCTCTGGGTCTGGGC No data
Right 1081594019 11:44446828-44446850 GCCTCTTTTTTCTATCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081594015 Original CRISPR GCCCAGACCCAGAGAGGAAG GGG (reversed) Intergenic
No off target data available for this crispr