ID: 1081594018

View in Genome Browser
Species Human (GRCh38)
Location 11:44446813-44446835
Sequence AAAGAGGCCCAGACCCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081594018_1081594019 -8 Left 1081594018 11:44446813-44446835 CCTCTCTGGGTCTGGGCCTCTTT No data
Right 1081594019 11:44446828-44446850 GCCTCTTTTTTCTATCAGCCTGG No data
1081594018_1081594021 2 Left 1081594018 11:44446813-44446835 CCTCTCTGGGTCTGGGCCTCTTT No data
Right 1081594021 11:44446838-44446860 TCTATCAGCCTGGCAGATTCTGG No data
1081594018_1081594023 11 Left 1081594018 11:44446813-44446835 CCTCTCTGGGTCTGGGCCTCTTT No data
Right 1081594023 11:44446847-44446869 CTGGCAGATTCTGGAACGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081594018 Original CRISPR AAAGAGGCCCAGACCCAGAG AGG (reversed) Intergenic
No off target data available for this crispr