ID: 1081594020

View in Genome Browser
Species Human (GRCh38)
Location 11:44446829-44446851
Sequence GCCAGGCTGATAGAAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081594020_1081594031 25 Left 1081594020 11:44446829-44446851 CCTCTTTTTTCTATCAGCCTGGC No data
Right 1081594031 11:44446877-44446899 TCAGCAGAAGCCCTGGGGTAGGG No data
1081594020_1081594030 24 Left 1081594020 11:44446829-44446851 CCTCTTTTTTCTATCAGCCTGGC No data
Right 1081594030 11:44446876-44446898 CTCAGCAGAAGCCCTGGGGTAGG No data
1081594020_1081594023 -5 Left 1081594020 11:44446829-44446851 CCTCTTTTTTCTATCAGCCTGGC No data
Right 1081594023 11:44446847-44446869 CTGGCAGATTCTGGAACGCCTGG No data
1081594020_1081594026 19 Left 1081594020 11:44446829-44446851 CCTCTTTTTTCTATCAGCCTGGC No data
Right 1081594026 11:44446871-44446893 GCCCTCTCAGCAGAAGCCCTGGG No data
1081594020_1081594025 18 Left 1081594020 11:44446829-44446851 CCTCTTTTTTCTATCAGCCTGGC No data
Right 1081594025 11:44446870-44446892 TGCCCTCTCAGCAGAAGCCCTGG No data
1081594020_1081594028 20 Left 1081594020 11:44446829-44446851 CCTCTTTTTTCTATCAGCCTGGC No data
Right 1081594028 11:44446872-44446894 CCCTCTCAGCAGAAGCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081594020 Original CRISPR GCCAGGCTGATAGAAAAAAG AGG (reversed) Intergenic
No off target data available for this crispr