ID: 1081594022

View in Genome Browser
Species Human (GRCh38)
Location 11:44446846-44446868
Sequence CAGGCGTTCCAGAATCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081594022_1081594036 20 Left 1081594022 11:44446846-44446868 CCTGGCAGATTCTGGAACGCCTG No data
Right 1081594036 11:44446889-44446911 CTGGGGTAGGGTTTCTGGTTGGG No data
1081594022_1081594038 29 Left 1081594022 11:44446846-44446868 CCTGGCAGATTCTGGAACGCCTG No data
Right 1081594038 11:44446898-44446920 GGTTTCTGGTTGGGTTTCAAGGG No data
1081594022_1081594030 7 Left 1081594022 11:44446846-44446868 CCTGGCAGATTCTGGAACGCCTG No data
Right 1081594030 11:44446876-44446898 CTCAGCAGAAGCCCTGGGGTAGG No data
1081594022_1081594035 19 Left 1081594022 11:44446846-44446868 CCTGGCAGATTCTGGAACGCCTG No data
Right 1081594035 11:44446888-44446910 CCTGGGGTAGGGTTTCTGGTTGG No data
1081594022_1081594025 1 Left 1081594022 11:44446846-44446868 CCTGGCAGATTCTGGAACGCCTG No data
Right 1081594025 11:44446870-44446892 TGCCCTCTCAGCAGAAGCCCTGG No data
1081594022_1081594026 2 Left 1081594022 11:44446846-44446868 CCTGGCAGATTCTGGAACGCCTG No data
Right 1081594026 11:44446871-44446893 GCCCTCTCAGCAGAAGCCCTGGG No data
1081594022_1081594032 15 Left 1081594022 11:44446846-44446868 CCTGGCAGATTCTGGAACGCCTG No data
Right 1081594032 11:44446884-44446906 AAGCCCTGGGGTAGGGTTTCTGG No data
1081594022_1081594028 3 Left 1081594022 11:44446846-44446868 CCTGGCAGATTCTGGAACGCCTG No data
Right 1081594028 11:44446872-44446894 CCCTCTCAGCAGAAGCCCTGGGG No data
1081594022_1081594037 28 Left 1081594022 11:44446846-44446868 CCTGGCAGATTCTGGAACGCCTG No data
Right 1081594037 11:44446897-44446919 GGGTTTCTGGTTGGGTTTCAAGG No data
1081594022_1081594031 8 Left 1081594022 11:44446846-44446868 CCTGGCAGATTCTGGAACGCCTG No data
Right 1081594031 11:44446877-44446899 TCAGCAGAAGCCCTGGGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081594022 Original CRISPR CAGGCGTTCCAGAATCTGCC AGG (reversed) Intergenic
No off target data available for this crispr