ID: 1081594023

View in Genome Browser
Species Human (GRCh38)
Location 11:44446847-44446869
Sequence CTGGCAGATTCTGGAACGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081594020_1081594023 -5 Left 1081594020 11:44446829-44446851 CCTCTTTTTTCTATCAGCCTGGC No data
Right 1081594023 11:44446847-44446869 CTGGCAGATTCTGGAACGCCTGG No data
1081594016_1081594023 16 Left 1081594016 11:44446808-44446830 CCCTTCCTCTCTGGGTCTGGGCC No data
Right 1081594023 11:44446847-44446869 CTGGCAGATTCTGGAACGCCTGG No data
1081594017_1081594023 15 Left 1081594017 11:44446809-44446831 CCTTCCTCTCTGGGTCTGGGCCT No data
Right 1081594023 11:44446847-44446869 CTGGCAGATTCTGGAACGCCTGG No data
1081594009_1081594023 27 Left 1081594009 11:44446797-44446819 CCAGTGAGACCCCCTTCCTCTCT No data
Right 1081594023 11:44446847-44446869 CTGGCAGATTCTGGAACGCCTGG No data
1081594018_1081594023 11 Left 1081594018 11:44446813-44446835 CCTCTCTGGGTCTGGGCCTCTTT No data
Right 1081594023 11:44446847-44446869 CTGGCAGATTCTGGAACGCCTGG No data
1081594013_1081594023 18 Left 1081594013 11:44446806-44446828 CCCCCTTCCTCTCTGGGTCTGGG No data
Right 1081594023 11:44446847-44446869 CTGGCAGATTCTGGAACGCCTGG No data
1081594015_1081594023 17 Left 1081594015 11:44446807-44446829 CCCCTTCCTCTCTGGGTCTGGGC No data
Right 1081594023 11:44446847-44446869 CTGGCAGATTCTGGAACGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081594023 Original CRISPR CTGGCAGATTCTGGAACGCC TGG Intergenic
No off target data available for this crispr