ID: 1081594028

View in Genome Browser
Species Human (GRCh38)
Location 11:44446872-44446894
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081594020_1081594028 20 Left 1081594020 11:44446829-44446851 CCTCTTTTTTCTATCAGCCTGGC No data
Right 1081594028 11:44446872-44446894 CCCTCTCAGCAGAAGCCCTGGGG No data
1081594022_1081594028 3 Left 1081594022 11:44446846-44446868 CCTGGCAGATTCTGGAACGCCTG No data
Right 1081594028 11:44446872-44446894 CCCTCTCAGCAGAAGCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081594028 Original CRISPR CCCTCTCAGCAGAAGCCCTG GGG Intergenic
No off target data available for this crispr