ID: 1081598084

View in Genome Browser
Species Human (GRCh38)
Location 11:44473133-44473155
Sequence TGCAATCATACCCATGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081598074_1081598084 18 Left 1081598074 11:44473092-44473114 CCCTGCCCTGGTTAGCCAGCCTT No data
Right 1081598084 11:44473133-44473155 TGCAATCATACCCATGGCTTTGG No data
1081598080_1081598084 3 Left 1081598080 11:44473107-44473129 CCAGCCTTGGAAGATGAGGCCAG No data
Right 1081598084 11:44473133-44473155 TGCAATCATACCCATGGCTTTGG No data
1081598078_1081598084 12 Left 1081598078 11:44473098-44473120 CCTGGTTAGCCAGCCTTGGAAGA No data
Right 1081598084 11:44473133-44473155 TGCAATCATACCCATGGCTTTGG No data
1081598081_1081598084 -1 Left 1081598081 11:44473111-44473133 CCTTGGAAGATGAGGCCAGCAAT No data
Right 1081598084 11:44473133-44473155 TGCAATCATACCCATGGCTTTGG No data
1081598072_1081598084 26 Left 1081598072 11:44473084-44473106 CCGTGATCCCCTGCCCTGGTTAG No data
Right 1081598084 11:44473133-44473155 TGCAATCATACCCATGGCTTTGG No data
1081598077_1081598084 13 Left 1081598077 11:44473097-44473119 CCCTGGTTAGCCAGCCTTGGAAG No data
Right 1081598084 11:44473133-44473155 TGCAATCATACCCATGGCTTTGG No data
1081598075_1081598084 17 Left 1081598075 11:44473093-44473115 CCTGCCCTGGTTAGCCAGCCTTG No data
Right 1081598084 11:44473133-44473155 TGCAATCATACCCATGGCTTTGG No data
1081598073_1081598084 19 Left 1081598073 11:44473091-44473113 CCCCTGCCCTGGTTAGCCAGCCT No data
Right 1081598084 11:44473133-44473155 TGCAATCATACCCATGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081598084 Original CRISPR TGCAATCATACCCATGGCTT TGG Intergenic
No off target data available for this crispr